eif1axa

Ensembl ID:
ENSDARG00000029003
ZFIN ID:
ZDB-GENE-041010-185
Description:
eukaryotic translation initiation factor 1A, X-chromosomal [Source:RefSeq peptide;Acc:NP_001006082]
Human Orthologues:
EIF1AX, EIF1AY
Human Descriptions:
eukaryotic translation initiation factor 1A, X-linked [Source:HGNC Symbol;Acc:3250]
eukaryotic translation initiation factor 1A, Y-linked [Source:HGNC Symbol;Acc:3252]
Mouse Orthologues:
AC079644.3, AC126554.1, BB287469, CT954323.1, Eif1a, Eif1ax, Gm2016, Gm2046, Gm4027, Gm5662, Gm8300
Mouse Descriptions:
eukaryotic translation initiation factor 1A Gene [Source:MGI Symbol;Acc:MGI:95298]
eukaryotic translation initiation factor 1A, X-linked Gene [Source:MGI Symbol;Acc:MGI:1913485]
eukaryotic translation initiation factor 1A-like 1 [Source:RefSeq peptide;Acc:NP_001171035]
expressed sequence BB287469 Pseudogene [Source:MGI Symbol;Acc:MGI:3034635]
predicted gene 2016 Gene [Source:MGI Symbol;Acc:MGI:3780185]
predicted gene 2046 Gene [Source:MGI Symbol;Acc:MGI:3780214]
predicted gene 4027 Gene [Source:MGI Symbol;Acc:MGI:3782201]
predicted gene 5662 Gene [Source:MGI Symbol;Acc:MGI:3648257]
predicted gene 8300 Gene [Source:MGI Symbol;Acc:MGI:3643794]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15746 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066645 Essential Splice Site 68 144 3 7
Genomic Location:
Chromosome 5 (position 25675654)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGGGGTCAAACGGCTCTGCCACATCCGAGGGAAGCTCCGCAAAAAGG[T/C]ATGATGAAGTTAATAAYGACCATGTTATGGRTATGAAAGATTTATCATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/brwfe0un