pcca

Ensembl ID:
ENSDARG00000028982
ZFIN ID:
ZDB-GENE-040718-246
Description:
propionyl-CoA carboxylase alpha chain, mitochondrial [Source:RefSeq peptide;Acc:NP_001002746]
Human Orthologue:
PCCA
Human Description:
propionyl CoA carboxylase, alpha polypeptide [Source:HGNC Symbol;Acc:8653]
Mouse Orthologue:
Pcca
Mouse Description:
propionyl-Coenzyme A carboxylase, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:97499]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1201 Essential Splice Site F2 line generated During 2017
sa5937 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17977 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1201
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034097 Essential Splice Site 432 709 15 23
ENSDART00000133905 Essential Splice Site 444 721 15 23
ENSDART00000135252   None 152 None 7
ENSDART00000136786   None 159 None 7
Genomic Location (Zv9):
Chromosome 1 (position 28854758)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29105587
KASP Assay ID:
554-1110.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAAGAAGGAAGCGACATCAGTATTTATTATGACCCTATGATTTCTAAG[G/A]TAATCAATGACCATCATGAAAGTCTAATTTCAATTAAGATGTCAGTTTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa5937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034097 Essential Splice Site 458 709 16 23
ENSDART00000133905 Essential Splice Site 470 721 16 23
ENSDART00000135252   None 152 None 7
ENSDART00000136786   None 159 None 7
Genomic Location (Zv9):
Chromosome 1 (position 28854910)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29105739
KASP Assay ID:
554-3742.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGCTCTGAAGAAAATGGAAGAAGCACTTGATAATTACGTGGTCAGAGG[T/C]AAATGGCCTCCKAAAGAATTATGACAAATGAAGGTGAAAACATTTCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17977
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034097 Nonsense 514 709 17 23
ENSDART00000133905 Nonsense 526 721 17 23
ENSDART00000135252   None 152 None 7
ENSDART00000136786   None 159 None 7
Genomic Location (Zv9):
Chromosome 1 (position 28855157)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29105986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACAGCAGGAGAAAGACAGGAGCTGCTTGCTACGGCTGCGGCACTCTA[T/A]ACAGCAGCACAGCTCCGCTCTCAGAGGTTCCTGGGGGATCTCAGGTGASA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link