pus3

Ensembl ID:
ENSDARG00000028976
ZFIN IDs:
ZDB-GENE-030131-9433, ZDB-GENE-030131-9433
Description:
tRNA pseudouridine synthase 3 [Source:RefSeq peptide;Acc:NP_956361]
Human Orthologue:
PUS3
Human Description:
pseudouridylate synthase 3 [Source:HGNC Symbol;Acc:25461]
Mouse Orthologue:
Pus3
Mouse Description:
pseudouridine synthase 3 Gene [Source:MGI Symbol;Acc:MGI:1914299]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32496 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048640 Nonsense 430 460 7 7
ENSDART00000062722 Nonsense 356 386 8 8
Genomic Location (Zv9):
Chromosome 24 (position 37826434)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36441350
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCAAGAAGAAGGAGAGAATGGAGAGGAGACCACTGTTTTCAGGGGG[A/T]AAAGATCCAAACATGCTCATCTGACAACAACAAACCAAATACAGAACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link