tekt2

Ensembl ID:
ENSDARG00000028973
ZFIN ID:
ZDB-GENE-040113-1
Description:
tektin 2 [Source:RefSeq peptide;Acc:NP_001017432]
Human Orthologue:
TEKT2
Human Description:
tektin 2 (testicular) [Source:HGNC Symbol;Acc:11725]
Mouse Orthologue:
Tekt2
Mouse Description:
tektin 2 Gene [Source:MGI Symbol;Acc:MGI:1346335]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13527 Nonsense Available for shipment Available now
sa23460 Nonsense Available for shipment Available now
sa25088 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13214 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046527 Nonsense 17 429 2 11
ENSDART00000059358 Nonsense 17 425 2 10
ENSDART00000135102 None None 284 1 9
Genomic Location:
Chromosome 19 (position 11268602)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGGCCACCTTAAGCTCGAAGCCRGCCTCACGCTACAGTGTTTCTGACT[G/A]GGCAACWAACAATAAGCAAATSTCAGATACTGCTGAACACAAACGCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046527 Nonsense 161 429 4 11
ENSDART00000059358 Nonsense 161 425 4 10
ENSDART00000135102 None 16 284 3 9
Genomic Location:
Chromosome 19 (position 11265925)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATGGAGCACAACGTGTCCTTCAACAGTGCATCGATCAGGCCTTTGAA[C/T]AGCTGTGGTAAGAACATTCAGATTTCAGGTTGGAAGCCCTCACTAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046527 Essential Splice Site 215 429 6 11
ENSDART00000059358 Essential Splice Site 211 425 5 10
ENSDART00000135102 Essential Splice Site 70 284 4 9
Genomic Location:
Chromosome 19 (position 11264072)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATCACCTGAGATCTCACTGAAGCCTAACCCTACAAGAGTGCCCCCTGG[G/A]TGAGTTTATGAGTAAACTATAAGCAAACATGCTATCTTTGCTTAATATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13214
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046527 Essential Splice Site 290 429 9 11
ENSDART00000059358 Essential Splice Site 286 425 8 10
ENSDART00000135102 Essential Splice Site 145 284 7 9
Genomic Location:
Chromosome 19 (position 11260340)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATGTTTATTTATTTGTTGATATTTCGATATGTGGGCYSATATGTTTC[A/T]GACTCAAGATGAGATTGCTGAGCTGGAGAAGGATATCATTGGCYTGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ovdkr87i