si:ch211-15i6.4

Ensembl ID:
ENSDARG00000028943
ZFIN ID:
ZDB-GENE-030219-89
Description:
hypothetical protein LOC560413 [Source:RefSeq peptide;Acc:NP_001038391]
Human Orthologue:
MTSS1L
Human Description:
metastasis suppressor 1-like [Source:HGNC Symbol;Acc:25094]
Mouse Orthologue:
Mtss1l
Mouse Description:
metastasis suppressor 1-like Gene [Source:MGI Symbol;Acc:MGI:3039591]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29000 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045232 Essential Splice Site 97 757 5 15
ENSDART00000061470 Essential Splice Site 145 808 5 16
ENSDART00000124843 Essential Splice Site 145 755 5 14
ENSDART00000144660   None 403 None 4
Genomic Location (Zv9):
Chromosome 18 (position 14378436)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14823854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTCTCTTGTTTATTTTTTGCCTTGTTTATTTTTTCTATTAATACTT[A/T]GTGCTCTAATGGAAAAAATGATTGGCCCACTCCAAGACAAGATTGAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link