taf1b

Ensembl ID:
ENSDARG00000028937
ZFIN ID:
ZDB-GENE-041008-2
Description:
TATA box-binding protein-associated factor RNA polymerase I subunit B [Source:RefSeq peptide;Acc:NP
Human Orthologue:
TAF1B
Human Description:
TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa [Source:HGNC Symbol;Acc
Mouse Orthologue:
Taf1b
Mouse Description:
TATA box binding protein (Tbp)-associated factor, RNA polymerase I, B Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13173 Nonsense Available for shipment Available now
sa30716 Nonsense Mutation detected in F1 DNA During 2015
sa29382 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa13173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049224 Nonsense 285 576 9 15
ENSDART00000062377 Nonsense 287 562 9 14
Genomic Location:
Chromosome 20 (position 29549276)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCAAAGATCATGAAGTTGCCGTCCTTCCCAACAATTTCTCAGGATTG[T/A]CTTTTCCACCCAGTTCCACTCACTGTCCGCTATCTGCTAGAGGCAAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049224 Nonsense 383 576 12 15
ENSDART00000062377 Nonsense 369 562 11 14
Genomic Location:
Chromosome 20 (position 29545966)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGGTAACGTGTTCTCGCATGCTTATCAGTCTTCAGTTTAGAAAGATG[G/A]TTTAACATCGTACAGCCTGTTTTAGAGCAAGCCAGACTCAAGGAGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049224 Nonsense 562 576 15 15
ENSDART00000062377 Nonsense 548 562 14 14
Genomic Location:
Chromosome 20 (position 29540446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCAACGTTGAGCGACGCTTCTTAAAGAAAAATTATCGGCTCGACAGT[C/T]GATTGACTTCTTCTCATCTGAAAAAGAAAAAAGGTCCAATTTTGTAACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2tv3pjrd