taf1b

Ensembl ID:
ENSDARG00000028937
ZFIN ID:
ZDB-GENE-041008-2
Description:
TATA box-binding protein-associated factor RNA polymerase I subunit B [Source:RefSeq peptide;Acc:NP
Human Orthologue:
TAF1B
Human Description:
TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa [Source:HGNC Symbol;Acc
Mouse Orthologue:
Taf1b
Mouse Description:
TATA box binding protein (Tbp)-associated factor, RNA polymerase I, B Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13173 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049224 Nonsense 285 576 9 15
ENSDART00000062377 Nonsense 287 562 9 14
Genomic Location:
Chromosome 20 (position 29549276)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCAAAGATCATGAAGTTGCCGTCCTTCCCAACAATTTCTCAGGATTG[T/A]CTTTTCCACCCAGTTCCACTCACTGTCCGCTATCTGCTAGAGGCAAACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2tv3pjrd