ppap2c

Ensembl ID:
ENSDARG00000028896
ZFIN ID:
ZDB-GENE-030131-7425
Description:
phosphatidic acid phosphatase type 2c [Source:RefSeq peptide;Acc:NP_956247]
Human Orthologue:
PPAP2C
Human Description:
phosphatidic acid phosphatase type 2C [Source:HGNC Symbol;Acc:9230]
Mouse Orthologue:
Ppap2c
Mouse Description:
phosphatidic acid phosphatase type 2C Gene [Source:MGI Symbol;Acc:MGI:1354945]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12820 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105551 Nonsense 78 273 3 6
ENSDART00000128719 Nonsense 80 275 5 8
ENSDART00000139411 Nonsense 81 276 3 6
Genomic Location (Zv9):
Chromosome 22 (position 21897717)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21550965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTACCTTGTTTTCCTTTTAGATCTGTTCGGGTGAAGCATATCTGGTGTA[C/A]AGCAAAAAAATCCACTCCAACTCCTCTTTTAATCAATATGTGTYAGCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link