SGSM1 (2 of 2)

Ensembl ID:
ENSDARG00000028857
Description:
small G protein signaling modulator 1 [Source:HGNC Symbol;Acc:29410]
Human Orthologue:
SGSM1
Human Description:
small G protein signaling modulator 1 [Source:HGNC Symbol;Acc:29410]
Mouse Orthologue:
Sgsm1
Mouse Description:
small G protein signaling modulator 1 Gene [Source:MGI Symbol;Acc:MGI:107320]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18376 Essential Splice Site Available for shipment Available now
sa40390 Nonsense Mutation detected in F1 DNA During 2017
sa17936 Nonsense Available for shipment Available now
sa26440 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18376
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047841 Essential Splice Site 27 1069 2 25
Genomic Location (Zv9):
Chromosome 5 (position 21831209)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19544081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCATTAATGCAATATTGTCCATTTTCTCTGTYCATAAATGTGTRTGTA[G/A]CTGCCGTCGAAGCCTGTGTGCTTCATGGRKTGAAGAGGAGAGCTGCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047841 Nonsense 679 1069 17 25
Genomic Location (Zv9):
Chromosome 5 (position 21868972)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19581844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAGCAAATCGAGTCTGAGCCCAAGAACGATGTTGGCAAACAGGTTTGC[A/T]AAATCTCAAACGGAACCCCTCAAAATGGCACCAGCTCTCCAGACTCCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047841 Nonsense 792 1069 18 25
Genomic Location (Zv9):
Chromosome 5 (position 21869483)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19582355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACACGGCATACTGAGCCAGATATTCCCAAAGCAAYAGAGGTCATGGAAW[C/A]KACTCCTCYAGAGCGGAAGATGAATGAGACTCRAGTAAGAGCGGACATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047841 Essential Splice Site 1041 1069 25 25
Genomic Location (Zv9):
Chromosome 5 (position 21876434)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19589306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTCACTGGGCGGTTGATTTGAATAATTATGTCCTGTTTTTTTATTCC[A/T]GAAATGGCTGAGCATCACAATATCAAGCAGATCCTGACTCTGTCTCGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link