calcr

Ensembl ID:
ENSDARG00000028845
ZFIN IDs:
ZDB-GENE-060503-420, ZDB-GENE-060503-420, ZDB-GENE-070424-193
Description:
Novel protein similar to vertebrate calcitonin receptor (CALCR) [Source:UniProtKB/TrEMBL;Acc:A5WVU8]
Human Orthologue:
CALCRL
Human Description:
calcitonin receptor-like [Source:HGNC Symbol;Acc:16709]
Mouse Orthologue:
Calcrl
Mouse Description:
calcitonin receptor-like Gene [Source:MGI Symbol;Acc:MGI:1926944]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17942 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17942
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051943 Essential Splice Site 416 598 12 15
ENSDART00000131471 Essential Splice Site 401 583 11 14
Genomic Location:
Chromosome 19 (position 41689373)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTTGGTGGACAGTACCTCTGATATGGGATTTATTATATTTTTCCACT[A/C]GCTGCTGGATGAGTGTGGAGACGCATCTGCTCTACGTGGTTCACGGCCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e95e4b8p