trim24

Ensembl ID:
ENSDARG00000028842
ZFIN ID:
ZDB-GENE-030131-5913
Description:
tripartite motif-containing 24 [Source:RefSeq peptide;Acc:NP_001002870]
Human Orthologues:
TRIM24, TRIM33
Human Descriptions:
tripartite motif-containing 24 [Source:HGNC Symbol;Acc:11812]
tripartite motif-containing 33 [Source:HGNC Symbol;Acc:16290]
Mouse Orthologues:
Trim24, Trim33
Mouse Descriptions:
tripartite motif-containing 24 Gene [Source:MGI Symbol;Acc:MGI:109275]
tripartite motif-containing 33 Gene [Source:MGI Symbol;Acc:MGI:2137357]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20311 Nonsense Mutation detected in F1 DNA During 2014
sa15261 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043483 Nonsense 369 961 8 18
Genomic Location:
Chromosome 4 (position 59444635)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACATGCCAAATTCAGTACCTCATGAGAGCAAAGTGCAACATCTCCTA[T/A]GTTCCCCAGAGCTTGGTGCGCTTCCAGTGTCGCTCTGCCTTTTGGGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043483 Nonsense 712 961 14 18
Genomic Location:
Chromosome 4 (position 59428011)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGAGGACTGGTGCGCGGTGTGCCAGAACGGAGGAGAGCTGCTCTGCTG[C/A]GACAAATGCCCCAAAGTCTTCCATCTCAGCTGCCACGTGCCCASTCTGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kpfj7ljj