nlk2

Ensembl ID:
ENSDARG00000028793
ZFIN IDs:
ZDB-GENE-080320-1, ZDB-GENE-080320-1
Description:
Nemo-like kinase2 [Source:UniProtKB/TrEMBL;Acc:A9ZMG5]
Human Orthologue:
NLK
Human Description:
nemo-like kinase [Source:HGNC Symbol;Acc:29858]
Mouse Orthologue:
Nlk
Mouse Description:
nemo like kinase Gene [Source:MGI Symbol;Acc:MGI:1201387]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16109 Essential Splice Site Available for shipment Available now
sa24989 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16109
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047248 Essential Splice Site 84 458 2 12
ENSDART00000123937 Essential Splice Site 159 533 1 11
Genomic Location (Zv9):
Chromosome 15 (position 29540108)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 30278411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATAGAGCCGGACAGACCGAWCGGATACGGAGCTTTCGGCGTGGTTTG[G/A]TGAGTGGAACWACTTCTGTGTTAACNNAGAATGCTCTAAATAATGCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047248 Nonsense 374 458 10 12
ENSDART00000123937 Nonsense 449 533 9 11
Genomic Location (Zv9):
Chromosome 15 (position 29677697)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 30416000
KASP Assay ID:
554-7753.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGATGAGGGGCGTCTGCGATACCACACCTGCATGTGCAAATGCTGCTA[C/A]ACCACGTCCTCCGGCCGCGTTTACACCAGTGACTTCGAACCCGTCACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link