tm9sf3

Ensembl ID:
ENSDARG00000028748
ZFIN ID:
ZDB-GENE-040426-2714
Description:
transmembrane 9 superfamily member 3 [Source:RefSeq peptide;Acc:NP_998554]
Human Orthologue:
TM9SF3
Human Description:
transmembrane 9 superfamily member 3 [Source:HGNC Symbol;Acc:21529]
Mouse Orthologue:
Tm9sf3
Mouse Description:
transmembrane 9 superfamily member 3 Gene [Source:MGI Symbol;Acc:MGI:1914262]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22233 Nonsense Mutation detected in F1 DNA During 2014
sa18308 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041609 Nonsense 48 586 2 15
Genomic Location:
Chromosome 13 (position 9236078)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACACAGATAAAGAAGAGGTGGTTTTATGGATGAATACAGTGGGCCCTTA[T/A]CACAACCGACAGGAGACCTATAAGTACTTCTCCCTACCGTTCTGTGTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041609 Nonsense 204 586 5 15
Genomic Location:
Chromosome 13 (position 9231960)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCATCYCYACAGGTCAAGTGGAAGAAATCTGATGTGAAATTTGAGGAT[A/T]GAKTTGACAAATACCTTGATCCATCTKTYTTTCAACACAGAGTAAGTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v4pwo5rr