LOC798498

Ensembl ID:
ENSDARG00000028725
Human Orthologue:
ADRA1A
Human Description:
adrenergic, alpha-1A-, receptor [Source:HGNC Symbol;Acc:277]
Mouse Orthologue:
Adra1a
Mouse Description:
adrenergic receptor, alpha 1a Gene [Source:MGI Symbol;Acc:MGI:104773]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3695 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030938 Nonsense 363 472 3 3
Genomic Location:
Chromosome 8 (position 5295805)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGCAAGAGATCCACACCGTCCCATACGCTCTACCAGAGCCACAGTCCC[A/T]GACACGGCCAGTCTCAGATTCTGGGTCTTTCGAGTCGTGACAATCCATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lz004qid