mapk14b

Ensembl ID:
ENSDARG00000028721
ZFIN ID:
ZDB-GENE-021007-1
Description:
Mitogen-activated protein kinase 14B [Source:UniProtKB/Swiss-Prot;Acc:Q9DGE1]
Human Orthologue:
MAPK14
Human Description:
mitogen-activated protein kinase 14 [Source:HGNC Symbol;Acc:6876]
Mouse Orthologue:
Mapk14
Mouse Description:
mitogen-activated protein kinase 14 Gene [Source:MGI Symbol;Acc:MGI:1346865]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35004 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030921 Nonsense 82 361 2 12
ENSDART00000040147 Nonsense 82 361 2 12
ENSDART00000132768 Nonsense 82 348 2 11
Genomic Location (Zv9):
Chromosome 11 (position 2701182)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2652920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCCAAACGCACGTACAGAGAACTGCGGCTGCTCAAACACATGAAGCAC[G/T]AGAATGTAAGAATCATCCACATTTATGACTCTTCTTACTTTAGGTACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link