mapk14b

Ensembl ID:
ENSDARG00000028721
ZFIN ID:
ZDB-GENE-021007-1
Description:
Mitogen-activated protein kinase 14B [Source:UniProtKB/Swiss-Prot;Acc:Q9DGE1]
Human Orthologue:
MAPK14
Human Description:
mitogen-activated protein kinase 14 [Source:HGNC Symbol;Acc:6876]
Mouse Orthologue:
Mapk14
Mouse Description:
mitogen-activated protein kinase 14 Gene [Source:MGI Symbol;Acc:MGI:1346865]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4398 Nonsense Mutation detected in F1 DNA During 2014
sa2623 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030921 Nonsense 312 361 11 12
ENSDART00000040147 Nonsense 312 361 11 12
ENSDART00000132768 Nonsense 312 348 11 11
Genomic Location:
Chromosome 11 (position 2735122)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCGGATCACTGCGTCACAGGCTCTCGCTCATCCGTATTTCGCTCAGTA[T/G]CACGATCCAGACGACGAACCAGAGGCTGATCCGTAYGACCAGAGCTTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030921 Essential Splice Site 340 361 11 12
ENSDART00000040147 Essential Splice Site 340 361 11 12
ENSDART00000132768 None 340 348 11 11
Genomic Location:
Chromosome 11 (position 2735206)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAYGACCAGAGCTTCGAGAGCCGAGACCTGGAGATCGAGGAGTGGAAAAG[T/C]AAGATTTACATACAAAATAGGAATTAAAGGACATGTTTTGTTTTACATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4arelsjh