exosc2

Ensembl ID:
ENSDARG00000028688
ZFIN ID:
ZDB-GENE-050417-27
Description:
exosome complex exonuclease RRP4 [Source:RefSeq peptide;Acc:NP_001017572]
Human Orthologue:
EXOSC2
Human Description:
exosome component 2 [Source:HGNC Symbol;Acc:17097]
Mouse Orthologue:
Exosc2
Mouse Description:
exosome component 2 Gene [Source:MGI Symbol;Acc:MGI:2385133]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33781 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40616 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10662 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33781
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032260 Essential Splice Site 2 254 1 9
Genomic Location (Zv9):
Chromosome 5 (position 75251879)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71353020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGGTTGTGCCTGGAGATGTGATCACCTCCGACACGGGCTTCATGAGG[T/C]ACACAGACATTAATAACTGGTATTAACTGAGCTGTTGTAGAATAAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032260 Essential Splice Site 36 254 2 9
Genomic Location (Zv9):
Chromosome 5 (position 75254379)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71355520
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTGGAGCGAGTCAACAAACTCATCTGTGTGAAACCGCTGAAGACCAG[G/A]TGCACACTGACTTACACTAACGCCACAGCACAGGTCTCAAACTAAATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10662
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032260 Nonsense 247 254 9 9
Genomic Location (Zv9):
Chromosome 5 (position 75257541)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71358682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACATCCTGAAGCCRGAGATCATGGAGGAGATTGTTCTGGAAACACGG[C/T]AGCGTCTGATGGAGCATGAAGGCTGAAACACCGCTCTATATATAATGMAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link