exosc2

Ensembl ID:
ENSDARG00000028688
ZFIN ID:
ZDB-GENE-050417-27
Description:
exosome complex exonuclease RRP4 [Source:RefSeq peptide;Acc:NP_001017572]
Human Orthologue:
EXOSC2
Human Description:
exosome component 2 [Source:HGNC Symbol;Acc:17097]
Mouse Orthologue:
Exosc2
Mouse Description:
exosome component 2 Gene [Source:MGI Symbol;Acc:MGI:2385133]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10662 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10662
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032260 Nonsense 247 254 9 9
Genomic Location:
Chromosome 5 (position 75257541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACATCCTGAAGCCRGAGATCATGGAGGAGATTGTTCTGGAAACACGG[C/T]AGCGTCTGATGGAGCATGAAGGCTGAAACACCGCTCTATATATAATGMAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1lk05bcs