jph2

Ensembl ID:
ENSDARG00000028625
ZFIN ID:
ZDB-GENE-030131-9848
Description:
junctophilin-2 [Source:RefSeq peptide;Acc:NP_001082833]
Human Orthologue:
JPH2
Human Description:
junctophilin 2 [Source:HGNC Symbol;Acc:14202]
Mouse Orthologue:
Jph2
Mouse Description:
junctophilin 2 Gene [Source:MGI Symbol;Acc:MGI:1891496]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8022 Nonsense Mutation detected in F1 DNA During 2014
sa19334 Nonsense Mutation detected in F1 DNA During 2014
sa798 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043429 Nonsense 14 781 1 6
ENSDART00000043429 Nonsense 14 781 1 6
Genomic Location:
Chromosome 23 (position 35807274)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAAGTGATGAGCGGAGGTCGCTTTGAGTTTGATGATGGCGGAGCTTA[T/G]TGTGGAGGCTGGGAGGGAGGAAAAGCGCACGGACACGGGATCTGCACCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19334
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043429 Nonsense 14 781 1 6
ENSDART00000043429 Nonsense 14 781 1 6
Genomic Location:
Chromosome 23 (position 35807274)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAAGTGATGAGCGGAGGTCGCTTTGAGTTTGATGATGGCGGAGCTTA[T/G]TGTGGAGGCTGGGAGGGAGGAAAAGCGCACGGACACGGGATCTGCACCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043429 Nonsense 35 781 1 6
Genomic Location:
Chromosome 23 (position 35807213)
KASP Assay ID:
554-0703.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAGGGAGGAAAAGCGCACGGACACGGGATCTGCACCGGACCCAAAGGA[C/T]AAGGAGAGTTCTCCGGCTCTTGGAATTACGGGTTCGAGGTGGTCGGAGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cvr52ow1