si:ch211-234h8.7

Ensembl ID:
ENSDARG00000028583
ZFIN ID:
ZDB-GENE-061009-16
Description:
solute carrier family 16, member 3 [Source:RefSeq peptide;Acc:NP_001119873]
Human Orthologue:
SLC16A3
Human Description:
solute carrier family 16, member 3 (monocarboxylic acid transporter 4) [Source:HGNC Symbol;Acc:10924
Mouse Orthologue:
Slc16a3
Mouse Description:
solute carrier family 16 (monocarboxylic acid transporters), member 3 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33235 Nonsense Mutation detected in F1 DNA During 2017
sa31343 Nonsense Available for shipment Available now
sa33236 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038525 Nonsense 99 501 2 4
Genomic Location (Zv9):
Chromosome 3 (position 36162899)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36034183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCGATTCGGATGTCGTCCAGTGATGTTGGTGGGCGGCCTATTTGCAT[C/A]GTTGGGAATGATCTTGGCATCGTTTGCCACGAGCATCATCCATATTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038525 Nonsense 104 501 2 4
Genomic Location (Zv9):
Chromosome 3 (position 36162914)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36034198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCCAGTGATGTTGGTGGGCGGCCTATTTGCATCGTTGGGAATGATCT[T/A]GGCATCGTTTGCCACGAGCATCATCCATATTTACTTGTGTACAGGAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038525 Nonsense 395 501 4 4
Genomic Location (Zv9):
Chromosome 3 (position 36166191)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36037475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTGTTCTCACTTTGTCAAGGCCGTCTTTTGGACCACACAAAGAAGTA[T/G]ATGTTTGTCTTCCTGCTGGCTGGGATCGAGGTTGTGTTGTCCGCTTTAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link