jkamp

Ensembl ID:
ENSDARG00000028581
ZFIN ID:
ZDB-GENE-040718-382
Description:
JNK1/MAPK8-associated membrane protein [Source:RefSeq peptide;Acc:NP_956776]
Human Orthologue:
JKAMP
Human Description:
JNK1/MAPK8-associated membrane protein [Source:HGNC Symbol;Acc:20184]
Mouse Orthologues:
4931417E11Rik, Jkamp
Mouse Descriptions:
JNK1/MAPK8-associated membrane protein Gene [Source:MGI Symbol;Acc:MGI:1915057]
RIKEN cDNA 4931417E11 gene Gene [Source:MGI Symbol;Acc:MGI:1913990]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9309 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44868 Nonsense Mutation detected in F1 DNA During 2017
sa32134 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039438 Essential Splice Site 151 309 4 7
ENSDART00000146786 Essential Splice Site 159 219 3 4

The following transcripts of ENSDARG00000028581 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 14322588)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14439688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGACTACGTCACCACGTTGCACTGCACACAGGAGGCTGTGTTTCCTCW[G/T]TGAGTGGCTTTTATARCGATATATGKATRTGATTTGAGGCATCAGTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039438 Nonsense 213 309 6 7
ENSDART00000146786   None 219 None 4

The following transcripts of ENSDARG00000028581 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 14319533)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTAATACCATTGTTTGTATATTTCCCTTTTGTTTATTTTACCAGACTA[T/G]GCGTTTCCGTATATTATTTTGGTCCTATCCTTGGTCACGTTGGCAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039438 Nonsense 268 309 7 7
ENSDART00000146786   None 219 None 4

The following transcripts of ENSDARG00000028581 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 14319277)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14436377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTTTAGCCATTGGCTCCTCCATGCATACGGTATTATTTCTATATCC[C/T]GACTGGATAAACTAGGCCAGGATTTGCCTCTGTTGGCTCTGGTGCCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link