jkamp

Ensembl ID:
ENSDARG00000028581
ZFIN ID:
ZDB-GENE-040718-382
Description:
JNK1/MAPK8-associated membrane protein [Source:RefSeq peptide;Acc:NP_956776]
Human Orthologue:
JKAMP
Human Description:
JNK1/MAPK8-associated membrane protein [Source:HGNC Symbol;Acc:20184]
Mouse Orthologues:
4931417E11Rik, Jkamp
Mouse Descriptions:
JNK1/MAPK8-associated membrane protein Gene [Source:MGI Symbol;Acc:MGI:1915057]
RIKEN cDNA 4931417E11 gene Gene [Source:MGI Symbol;Acc:MGI:1913990]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9309 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32134 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039438 Essential Splice Site 151 309 4 7
ENSDART00000146786 Essential Splice Site 159 219 3 4

The following transcripts of ENSDARG00000028581 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 14322588)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14439688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGACTACGTCACCACGTTGCACTGCACACAGGAGGCTGTGTTTCCTCW[G/T]TGAGTGGCTTTTATARCGATATATGKATRTGATTTGAGGCATCAGTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039438 Nonsense 268 309 7 7
ENSDART00000146786   None 219 None 4

The following transcripts of ENSDARG00000028581 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 14319277)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14436377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTTTAGCCATTGGCTCCTCCATGCATACGGTATTATTTCTATATCC[C/T]GACTGGATAAACTAGGCCAGGATTTGCCTCTGTTGGCTCTGGTGCCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link