LOC570173

Ensembl ID:
ENSDARG00000028552
Human Orthologue:
MIR3187
Human Description:
microRNA 3187 [Source:HGNC Symbol;Acc:38319]
Mouse Orthologue:
BC005764
Mouse Description:
cDNA sequence BC005764 Gene [Source:MGI Symbol;Acc:MGI:2388640]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13261 Nonsense Available for shipment Available now
sa16136 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022823 Nonsense 99 694 3 7
Genomic Location:
Chromosome 11 (position 14392458)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCCCCCATCTTTTGTCCAGATWATGATGGGTGAAGGTCTACWGTATTG[T/A]ATGCAGTCCAAACTGAAGGTTCGACCTGGGATTGAGGGAAGCATCAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022823 Nonsense 476 694 7 7
Genomic Location:
Chromosome 11 (position 14401021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAACCCACCTACAGGTCCAAAAGCAGTGATGACCCCTCGCCCTCCCACA[C/T]AGYCCTCAATTCCCYCWCCTGTATCCCCTAAAAGTGCYAGCACTAGAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g6j0z7wt