LOC570173

Ensembl ID:
ENSDARG00000028552
Human Orthologue:
MIR3187
Human Description:
microRNA 3187 [Source:HGNC Symbol;Acc:38319]
Mouse Orthologue:
BC005764
Mouse Description:
cDNA sequence BC005764 Gene [Source:MGI Symbol;Acc:MGI:2388640]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35050 Nonsense Mutation detected in F1 DNA During 2016
sa13261 Nonsense Available for shipment Available now
sa16136 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022823 Nonsense 37 694 2 7
Genomic Location:
Chromosome 11 (position 14392135)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTTCCCTTGTAAATCTTAGTTACCCATTGTGGCATCCTCCATGGTTT[C/A]GCTGTACTTTCTGGAACTGACGGACGTGCTCCAGCCAGCGCAGGTGGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022823 Nonsense 99 694 3 7
Genomic Location:
Chromosome 11 (position 14392458)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCCCCCATCTTTTGTCCAGATWATGATGGGTGAAGGTCTACWGTATTG[T/A]ATGCAGTCCAAACTGAAGGTTCGACCTGGGATTGAGGGAAGCATCAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022823 Nonsense 476 694 7 7
Genomic Location:
Chromosome 11 (position 14401021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAACCCACCTACAGGTCCAAAAGCAGTGATGACCCCTCGCCCTCCCACA[C/T]AGYCCTCAATTCCCYCWCCTGTATCCCCTAAAAGTGCYAGCACTAGAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link