fbxw11a

Ensembl ID:
ENSDARG00000028543
ZFIN ID:
ZDB-GENE-030131-6305
Description:
F-box and WD-40 domain protein 11a [Source:RefSeq peptide;Acc:NP_958467]
Human Orthologue:
FBXW11
Human Description:
F-box and WD repeat domain containing 11 [Source:HGNC Symbol;Acc:13607]
Mouse Orthologue:
Fbxw11
Mouse Description:
F-box and WD-40 domain protein 11 Gene [Source:MGI Symbol;Acc:MGI:2144023]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12221 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036901 Essential Splice Site 172 527 4 13
Genomic Location:
Chromosome 14 (position 2149257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGTGCGAACCGACCCACTGTGGAAAGGCCTGTCAGAGCGGCATCAATG[G/A]TAAAAGAACATNNNNACACTACATGTCACAGACGTAATGATGTTTCTACTATAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ywwx0jgu