fbxw11a

Ensembl ID:
ENSDARG00000028543
ZFIN ID:
ZDB-GENE-030131-6305
Description:
F-box and WD-40 domain protein 11a [Source:RefSeq peptide;Acc:NP_958467]
Human Orthologue:
FBXW11
Human Description:
F-box and WD repeat domain containing 11 [Source:HGNC Symbol;Acc:13607]
Mouse Orthologue:
Fbxw11
Mouse Description:
F-box and WD-40 domain protein 11 Gene [Source:MGI Symbol;Acc:MGI:2144023]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31968 Essential Splice Site Available for shipment Available now
sa12221 Essential Splice Site Available for shipment Available now
sa42328 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036901 Essential Splice Site 13 527 1 13
Genomic Location (Zv9):
Chromosome 14 (position 2127792)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150273.1 28829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACAATAATATGGATCCGGACAAGGAGGACAAAACCCTGGAGCTGATG[G/A]TACGTGCCGCCCGGTATCCACGACACCTCCTGCTCTGTATGTTTATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036901 Essential Splice Site 172 527 4 13
Genomic Location (Zv9):
Chromosome 14 (position 2149257)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150273.1 50294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGTGCGAACCGACCCACTGTGGAAAGGCCTGTCAGAGCGGCATCAATG[G/A]TAAAAGAACATNNNNACACTACATGTCACAGACGTAATGATGTTTCTACTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036901 Nonsense 512 527 12 13
Genomic Location (Zv9):
Chromosome 14 (position 2162985)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150273.1 64022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACGACACAATCCTTATATGGGACTTCCTGAATGTGTCCAGCAATGGG[C/T]AGTCGGACGGTCGGTCGCCCTCTCGGACATACACATACGTCTCCAGATAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link