si:ch211-114c12.2

Ensembl ID:
ENSDARG00000028542
ZFIN ID:
ZDB-GENE-030131-8522
Description:
hypothetical protein LOC336578 [Source:RefSeq peptide;Acc:NP_001002300]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8780 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029719 Nonsense 225 613 3 10

The following transcripts of ENSDARG00000028542 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 25799762)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23627027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCTCATCCCCACAGTGGGGATTCGAGGTTCCCTGGCCCACCCCACAGA[A/T]AGCCCAGAGAATTTCATGGAAGGAGTTCATATCCAGAGAGGTACACAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link