morc2

Ensembl ID:
ENSDARG00000028539
ZFIN ID:
ZDB-GENE-040822-40
Description:
MORC family CW-type zinc finger 2 [Source:RefSeq peptide;Acc:NP_001003994]
Human Orthologue:
MORC2
Human Description:
MORC family CW-type zinc finger 2 [Source:HGNC Symbol;Acc:23573]
Mouse Orthologues:
Morc2a, Morc2b
Mouse Descriptions:
microrchidia 2A Gene [Source:MGI Symbol;Acc:MGI:1921772]
microrchidia 2B Gene [Source:MGI Symbol;Acc:MGI:3045293]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14049 Essential Splice Site Available for shipment Available now
sa15920 Nonsense Available for shipment Available now
sa1428 Nonsense Available for shipment Available now
sa13755 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14049
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037973 Essential Splice Site 41 1035 3 27
Genomic Location:
Chromosome 25 (position 3796342)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCACGAGTTTCTWTTCGGAGCTTTGGCTGAACTTGTGGACAACTCAAGG[T/C]ACAAAAACTGTTGATTATTAARTATTTCAGAYGCATTAAATCATATCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037973 Nonsense 418 1035 15 27
Genomic Location:
Chromosome 25 (position 3781038)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GNNNNTNNNNTTGTATCAGGGCCTGTGGGGGTGTTGTAGGAGTGGTGGATGTTCCCTA[T/A]CTAGTGCTCGAGCCAACGCACAAYAAGCAGGACTTTGCAGATGCTAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037973 Nonsense 519 1035 17 27
Genomic Location:
Chromosome 25 (position 3778291)
KASP Assay ID:
554-1349.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAAATGGCGGACGTTGCCGTTTCAGATGGACGCCGTGGACAAGCGCTA[T/A]CCTGACAGTTGGGTGTGTTTAATGAACCCGGACGGATCCCAGGACAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037973 Essential Splice Site 860 1035 23 27
Genomic Location:
Chromosome 25 (position 3773501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAGTCAAGTTCGACTACGTTCCCATGAACACTCCAAGAGATCGCTGG[T/A]ACATAAATAYACACTAAAATCAATGTGTATTATGCAAATTAYATCAGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gklqe8sc