macf1

Ensembl ID:
ENSDARG00000028533
ZFIN ID:
ZDB-GENE-030131-3606
Description:
Novel protein similar to vertebrate microtubule-actin crosslinking factor 1 (MACF1) [Source:UniProtK
Human Orthologue:
MACF1
Human Description:
microtubule-actin crosslinking factor 1 [Source:HGNC Symbol;Acc:13664]
Mouse Orthologue:
Macf1
Mouse Description:
microtubule-actin crosslinking factor 1 Gene [Source:MGI Symbol;Acc:MGI:108559]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12481 Nonsense Available for shipment Available now
sa7884 Nonsense Mutation detected in F1 DNA During 2014
sa12708 Nonsense Available for shipment Available now
sa4061 Nonsense Mutation detected in F1 DNA During 2014
sa7883 Nonsense Mutation detected in F1 DNA During 2014
sa15741 Nonsense Available for shipment Available now
sa11432 Nonsense Available for shipment Available now
sa13865 Nonsense Available for shipment Available now
sa23566 Nonsense Mutation detected in F1 DNA During 2014
sa17558 Nonsense Available for shipment Available now
sa4817 Nonsense Mutation detected in F1 DNA During 2014
sa25094 Nonsense Mutation detected in F1 DNA During 2014
sa23565 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535 None None 134 None 3
ENSDART00000039136 None None 2818 None 41
ENSDART00000054274 Nonsense 34 7964 2 97
ENSDART00000140075 Nonsense 77 1586 2 34
ENSDART00000144798 None None 248 None 4
ENSDART00000146394 None None 2898 None 43
ENSDART00000147054 None None 180 None 4
Genomic Location:
Chromosome 19 (position 36770295)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTCTTGTTTTCTGCTGTTTCCTCCTCTCTMTCTCTCTCTTCTCAGATGAA[C/T]GAGACCGGGTGCAAAAGAAAACTTTCACAAAATGGGTCAACAAACAWCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535 None None 134 None 3
ENSDART00000039136 None None 2818 None 41
ENSDART00000054274 Nonsense 207 7964 7 97
ENSDART00000140075 Nonsense 250 1586 7 34
ENSDART00000144798 None None 248 None 4
ENSDART00000146394 None None 2898 None 43
ENSDART00000147054 None None 180 None 4
Genomic Location:
Chromosome 19 (position 36742016)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTATGTCNNNNNNNNNATTTTTAGGCCGGACCTAATTGACATGCAAGTGGTTGCGCAA[C/T]AGAGTAACCGTGAGAACCTTGAACAGGCCTTTGAGATTGCCGAGTCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535 None None 134 None 3
ENSDART00000039136 None None 2818 None 41
ENSDART00000054274 Nonsense 553 7964 14 97
ENSDART00000140075 Nonsense 596 1586 14 34
ENSDART00000144798 None None 248 None 4
ENSDART00000146394 None None 2898 None 43
ENSDART00000147054 None None 180 None 4
Genomic Location:
Chromosome 19 (position 36732705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTAGCCATGTCCTCCTCTGAGGATGAAGGCAGTCTGCGCTTTATTTA[T/A]GAGCTGCTGGGATGGGTWGAAGAAAMGCAAGATCTGCTGGAGCGAGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535 None None 134 None 3
ENSDART00000039136 None None 2818 None 41
ENSDART00000054274 Nonsense 638 7964 16 97
ENSDART00000140075 Nonsense 681 1586 16 34
ENSDART00000144798 None None 248 None 4
ENSDART00000146394 None None 2898 None 43
ENSDART00000147054 None None 180 None 4
Genomic Location:
Chromosome 19 (position 36730072)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGGTGTTATAAATGCGGTTTTGTGTTGTCGCAGGAACATTCGTCATGG[C/T]GACTGCGTTGCCTGGAGAGCCTTCGAGCTTTTGTGTCCCACTGCACCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535 None None 134 None 3
ENSDART00000039136 None None 2818 None 41
ENSDART00000054274 Nonsense 753 7964 18 97
ENSDART00000140075 Nonsense 796 1586 18 34
ENSDART00000144798 None None 248 None 4
ENSDART00000146394 None None 2898 None 43
ENSDART00000147054 None None 180 None 4
Genomic Location:
Chromosome 19 (position 36726187)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCTGCGTATGTGTGGAGCAGCACCTCAAGGACAACACTGCCTAYTTC[C/T]AGGTACTTATTTAAACCTTTTTGAATTGTTTATTATTTTTACTTTTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535 None None 134 None 3
ENSDART00000039136 None None 2818 None 41
ENSDART00000054274 Nonsense 3806 7964 35 97
ENSDART00000140075 None None 1586 None 34
ENSDART00000144798 None None 248 None 4
ENSDART00000146394 None None 2898 None 43
ENSDART00000147054 None None 180 None 4
Genomic Location:
Chromosome 19 (position 36691341)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGRTTATGCCAGAGTCTGATAACACGCAAAAGGAAGTGGTGGAAGAATA[T/A]CCAATGGGTTCAGTGGAGAGACAACCTGAAGTTCTTCAAGTTAATATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535 None None 134 None 3
ENSDART00000039136 None None 2818 None 41
ENSDART00000054274 Nonsense 4082 7964 39 97
ENSDART00000140075 None None 1586 None 34
ENSDART00000144798 Nonsense 248 248 4 4
ENSDART00000146394 None None 2898 None 43
ENSDART00000147054 None None 180 None 4
Genomic Location:
Chromosome 19 (position 36689153)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATGCCAGAGCAGAGGCACTATTAGCCCARCAGATGAGAGAGCATGAA[C/T]GACTGAAGAAAGAACAGAAAGWGAAAGAAGAGAAAATGGAAAAAGAGAGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535 None None 134 None 3
ENSDART00000039136 Nonsense 196 2818 2 41
ENSDART00000054274 Nonsense 5227 7964 56 97
ENSDART00000140075 None None 1586 None 34
ENSDART00000144798 None None 248 None 4
ENSDART00000146394 Nonsense 276 2898 4 43
ENSDART00000147054 None None 180 None 4
Genomic Location:
Chromosome 19 (position 36669821)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTGGGGAGATCCGCTCGGAACTGGAACAAAGACGGGGACAATTGTCC[C/T]ARGCTGAACAGCTGTGTACGGAGCTCAGCGCAATTGTGGCTGAACCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535 None None 134 None 3
ENSDART00000039136 Nonsense 214 2818 2 41
ENSDART00000054274 Nonsense 5245 7964 56 97
ENSDART00000140075 None None 1586 None 34
ENSDART00000144798 None None 248 None 4
ENSDART00000146394 Nonsense 294 2898 4 43
ENSDART00000147054 None None 180 None 4
Genomic Location:
Chromosome 19 (position 36669767)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAACAGCTGTGTACGGAGCTCAGCGCAATTGTGGCTGAACCATATCTC[A/T]GAGACGAGTTGCACAAGAGACTGGAAAGCGTGAGCGGCCCCCTCAAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535 None None 134 None 3
ENSDART00000039136 None None 2818 None 41
ENSDART00000054274 Nonsense 6081 7964 63 97
ENSDART00000140075 None None 1586 None 34
ENSDART00000144798 None None 248 None 4
ENSDART00000146394 None None 2898 None 43
ENSDART00000147054 None None 180 None 4
Genomic Location:
Chromosome 19 (position 36630534)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTAGCTGAGGTGGCCCAGAGACTGGCTGAGGTCTCAGTSCAGAGTTA[T/A]CAGCCGGAGCWCCTAGAGCAGCAGCACAAACACACACTGGTATGATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535 None None 134 None 3
ENSDART00000039136 Nonsense 988 2818 10 41
ENSDART00000054274 Nonsense 6128 7964 65 97
ENSDART00000140075 None None 1586 None 34
ENSDART00000144798 None None 248 None 4
ENSDART00000146394 Nonsense 1068 2898 12 43
ENSDART00000147054 None None 180 None 4
Genomic Location:
Chromosome 19 (position 36627716)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCATGTCTGGTCTGTCTGTCTGYCTGTGACAGGCGAGGAGGTCTTGT[T/A]GATCCAAGAGAAGTTGGATGGCATCAAAAGTCGCTACGCTGAAATGACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535 None None 134 None 3
ENSDART00000039136 Nonsense 1113 2818 11 41
ENSDART00000054274 Nonsense 6253 7964 66 97
ENSDART00000140075 None None 1586 None 34
ENSDART00000144798 None None 248 None 4
ENSDART00000146394 Nonsense 1193 2898 13 43
ENSDART00000147054 None None 180 None 4
Genomic Location:
Chromosome 19 (position 36626874)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTGCTGATGCCAATCAGCGATACCGCCAAGCAGACGAGACCATCACA[C/T]AGAGAGTGCAGTTAGTGCAGGCTGCCATCCAAAGGTCACAGCAGGTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535 None None 134 None 3
ENSDART00000039136 Nonsense 1512 2818 17 41
ENSDART00000054274 Nonsense 6652 7964 72 97
ENSDART00000140075 None None 1586 None 34
ENSDART00000144798 None None 248 None 4
ENSDART00000146394 Nonsense 1592 2898 19 43
ENSDART00000147054 None None 180 None 4
Genomic Location:
Chromosome 19 (position 36618359)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCATTAAAGCAGAGACAGATGGGCTGAGGGAGGAACTGGAGATCGTA[C/T]GAACACTCGGAGCTGACCTCATCTTTGCCTGCGGAGAGACTGAAAAACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lyldfg3j