macf1

Ensembl ID:
ENSDARG00000028533
ZFIN ID:
ZDB-GENE-030131-3606
Description:
Novel protein similar to vertebrate microtubule-actin crosslinking factor 1 (MACF1) [Source:UniProtK
Human Orthologue:
MACF1
Human Description:
microtubule-actin crosslinking factor 1 [Source:HGNC Symbol;Acc:13664]
Mouse Orthologue:
Macf1
Mouse Description:
microtubule-actin crosslinking factor 1 Gene [Source:MGI Symbol;Acc:MGI:108559]

Alleles

There are 18 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12481 Nonsense Available for shipment Available now
sa36881 Nonsense Mutation detected in F1 DNA During 2016
sa12708 Nonsense Available for shipment Available now
sa39255 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36880 Nonsense Mutation detected in F1 DNA During 2016
sa43318 Nonsense Mutation detected in F1 DNA During 2016
sa36879 Nonsense Mutation detected in F1 DNA During 2016
sa15741 Nonsense Available for shipment Available now
sa11432 Nonsense Available for shipment Available now
sa13865 Nonsense Available for shipment Available now
sa23566 Nonsense Mutation detected in F1 DNA During 2016
sa36878 Nonsense Mutation detected in F1 DNA During 2016
sa32250 Nonsense Mutation detected in F1 DNA During 2016
sa17558 Nonsense Available for shipment Available now
sa25094 Nonsense Mutation detected in F1 DNA During 2016
sa36877 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23565 Nonsense Mutation detected in F1 DNA During 2016
sa43317 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136   None 2818 None 41
ENSDART00000054274 Nonsense 34 7964 2 97
ENSDART00000140075 Nonsense 77 1586 2 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394   None 2898 None 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36770295)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35634815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTCTTGTTTTCTGCTGTTTCCTCCTCTCTMTCTCTCTCTTCTCAGATGAA[C/T]GAGACCGGGTGCAAAAGAAAACTTTCACAAAATGGGTCAACAAACAWCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136   None 2818 None 41
ENSDART00000054274 Nonsense 164 7964 6 97
ENSDART00000140075 Nonsense 207 1586 6 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394   None 2898 None 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36742440)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35606960
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGTCAGGTGACCTCACGGCGAAAGAGAAGCTGCTAATATGGAGTCAA[C/T]AGGCCACTGAGGGCTACCCCGGTCTACGCTGTACCAATTTCTCCTCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136   None 2818 None 41
ENSDART00000054274 Nonsense 553 7964 14 97
ENSDART00000140075 Nonsense 596 1586 14 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394   None 2898 None 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36732705)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35597225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTAGCCATGTCCTCCTCTGAGGATGAAGGCAGTCTGCGCTTTATTTA[T/A]GAGCTGCTGGGATGGGTWGAAGAAAMGCAAGATCTGCTGGAGCGAGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136   None 2818 None 41
ENSDART00000054274 Essential Splice Site 1228 7964 27 97
ENSDART00000140075 Essential Splice Site 1271 1586 27 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394   None 2898 None 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36708007)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35572527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGCTTACAGACAGGTGGAGTGGAGTCCGCAGGCAGATGGAGACACG[G/A]TGAGTCCTTCACAAGACTATTATCATGTGGGTTGTTGACATGGTTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136   None 2818 None 41
ENSDART00000054274 Nonsense 2696 7964 35 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394   None 2898 None 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36694671)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35559191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTACATAATGTGAACTTACAAGAGAAAGTTTTGCCATCAGAAAAGTA[T/G]AAAGAATCCAGGATTAAGGAAGACGAGACTGCAAGCAAGAAGACCAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136   None 2818 None 41
ENSDART00000054274 Nonsense 2882 7964 35 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394   None 2898 None 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36694115)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35558635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAGATAAAACAGACAGGAAGAAACTTGATATGAGTAGGAGTTGTGAA[C/T]AAGCTAAGGAAAGACTTTCCTCATTGACAGGCACAAAAAGCCCATTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136   None 2818 None 41
ENSDART00000054274 Nonsense 3108 7964 35 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394   None 2898 None 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36693437)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35557957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAATTTGAGAATATGCCTATGGAACGACAGCAGGGTGATCTTGAAATT[A/T]AAGGTGCCGGCCATATGAGAAAAGATGGGCTTGAAACAGAGATCTTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136   None 2818 None 41
ENSDART00000054274 Nonsense 3806 7964 35 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394   None 2898 None 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36691341)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35555861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGRTTATGCCAGAGTCTGATAACACGCAAAAGGAAGTGGTGGAAGAATA[T/A]CCAATGGGTTCAGTGGAGAGACAACCTGAAGTTCTTCAAGTTAATATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136   None 2818 None 41
ENSDART00000054274 Nonsense 4082 7964 39 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798 Nonsense 248 248 4 4
ENSDART00000146394   None 2898 None 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36689153)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35553673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATGCCAGAGCAGAGGCACTATTAGCCCARCAGATGAGAGAGCATGAA[C/T]GACTGAAGAAAGAACAGAAAGWGAAAGAAGAGAAAATGGAAAAAGAGAGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136 Nonsense 196 2818 2 41
ENSDART00000054274 Nonsense 5227 7964 56 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394 Nonsense 276 2898 4 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36669821)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35534341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTGGGGAGATCCGCTCGGAACTGGAACAAAGACGGGGACAATTGTCC[C/T]ARGCTGAACAGCTGTGTACGGAGCTCAGCGCAATTGTGGCTGAACCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136 Nonsense 214 2818 2 41
ENSDART00000054274 Nonsense 5245 7964 56 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394 Nonsense 294 2898 4 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36669767)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35534287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAACAGCTGTGTACGGAGCTCAGCGCAATTGTGGCTGAACCATATCTC[A/T]GAGACGAGTTGCACAAGAGACTGGAAAGCGTGAGCGGCCCCCTCAAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136 Nonsense 330 2818 3 41
ENSDART00000054274 Nonsense 5361 7964 57 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394 Nonsense 410 2898 5 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36667807)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35532327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCATCTCTCCTGGCATCCCTTCCTGCGGGAGATGAGCGGTTAGCCTTA[C/T]AGACTCGCTTGAACAACTTACGGCAAGACTGGGAGGTCTTAAACCAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32250
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136 Nonsense 503 2818 3 41
ENSDART00000054274 Nonsense 5534 7964 57 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394 Nonsense 583 2898 5 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36667288)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35531808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCATCAGATCGAGGTTCAAGAGGCGCTTGGACCACAAGCTTGTAGCAAC[A/T]AAAGCCTGGAGCGTCTGCGAAGCCAACAGGAGCTGTTAAACTCTGTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136   None 2818 None 41
ENSDART00000054274 Nonsense 6081 7964 63 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394   None 2898 None 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36630534)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35495054
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTAGCTGAGGTGGCCCAGAGACTGGCTGAGGTCTCAGTSCAGAGTTA[T/A]CAGCCGGAGCWCCTAGAGCAGCAGCACAAACACACACTGGTATGATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136 Nonsense 1113 2818 11 41
ENSDART00000054274 Nonsense 6253 7964 66 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394 Nonsense 1193 2898 13 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36626874)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35491394
KASP Assay ID:
554-7690.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTGCTGATGCCAATCAGCGATACCGCCAAGCAGACGAGACCATCACA[C/T]AGAGAGTGCAGTTAGTGCAGGCTGCCATCCAAAGGTCACAGCAGGTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136 Essential Splice Site 1345 2818 15 41
ENSDART00000054274 Essential Splice Site 6485 7964 70 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394 Essential Splice Site 1425 2898 17 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36621414)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35485934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTAGTGTGCTGTATGTGCTCTGACCATCGTCATCTCTCTATCATTTCA[G/T]TTTCATGATAAGATGGACCCTCTGTTGGAGACTCTGGAAGGCGCAGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136 Nonsense 1512 2818 17 41
ENSDART00000054274 Nonsense 6652 7964 72 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394 Nonsense 1592 2898 19 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36618359)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35482879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCATTAAAGCAGAGACAGATGGGCTGAGGGAGGAACTGGAGATCGTA[C/T]GAACACTCGGAGCTGACCTCATCTTTGCCTGCGGAGAGACTGAAAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007535   None 134 None 3
ENSDART00000039136 Essential Splice Site 2220 2818 30 41
ENSDART00000054274 Essential Splice Site 7360 7964 85 97
ENSDART00000140075   None 1586 None 34
ENSDART00000144798   None 248 None 4
ENSDART00000146394 Essential Splice Site 2300 2898 32 43
ENSDART00000147054   None 180 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36609092)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35473612
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCCTGTCCGTTTCAAAGCAGACGCGCCTCCAGCAGGCTCTTAAACAGG[T/C]ACGGCTGACCCTTATTTACACTTCTATTGTAATGCTTTTGAAAGACGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link