NP_001177687.1

Ensembl ID:
ENSDARG00000028524
Description:
collagen type V alpha-3b [Source:RefSeq peptide;Acc:NP_001177687]
Human Orthologue:
COL5A3
Human Description:
collagen, type V, alpha 3 [Source:HGNC Symbol;Acc:14864]
Mouse Orthologue:
Col5a3
Mouse Description:
collagen, type V, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:1858212]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32811 Nonsense Mutation detected in F1 DNA During 2017
sa9301 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12865 Nonsense Available for shipment Available now
sa19639 Essential Splice Site Available for shipment Available now
sa13950 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014072 Nonsense 79 1675 2 64
Genomic Location (Zv9):
Chromosome 1 (position 60259597)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58577294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGGCTTATAAGATTGACAAGAAAATCCAAGTTAGTGTGCCAACCAGC[C/T]AGCTCTTCCCAGGTATGAAGCACACACACACTCACACACACACTCACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9301
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014072 Essential Splice Site 963 1675 39 64
Genomic Location (Zv9):
Chromosome 1 (position 60244663)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58562360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTGGATTAAAGGGAGGGACGGGGCCAATCGGGCCCCCAGGACCTGCYG[T/C]ATGTGTTCAGATCTCAGTATCTTMAGWAATCTCTCAACACTCATGRATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014072 Nonsense 1082 1675 44 64
Genomic Location (Zv9):
Chromosome 1 (position 60239400)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58557097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTGTGTGTGTGTCAGGGTGTGGATGGTGAGGTYGGGCCTACAGGA[C/T]AGCAGGGCAWGTACGGACAGAAAGGAGACGAAGGGGCCCGAGGATTYAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014072 Essential Splice Site 1323 1675 54 64
Genomic Location (Zv9):
Chromosome 1 (position 60234249)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58552047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTGGGAAGCCGGGTCCTCAAGGTCTTCCAGGAATCCCAGGACCAGCG[G/A]TGAGATCCTCGACTCCTCAGGGGGTTTCCACACTTCCACACAGCAGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014072 Essential Splice Site 1323 1675 54 64
Genomic Location (Zv9):
Chromosome 1 (position 60234248)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58552046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTMTGGGAAGCCGGGTCCKCAAGGTCTTCCAGGAAWCCCAGGACCAGCGG[T/C]GAGATCCTCGACTCCTCAGGRGGTTTCCACACTTCCACAMAGCAGGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link