LOC556064

Ensembl ID:
ENSDARG00000028521
Human Orthologue:
C1QL1
Human Description:
complement component 1, q subcomponent-like 1 [Source:HGNC Symbol;Acc:24182]
Mouse Orthologue:
C1ql1
Mouse Description:
complement component 1, q subcomponent-like 1 Gene [Source:MGI Symbol;Acc:MGI:1344400]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15061 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15061
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061824 Nonsense 218 263 2 2
Genomic Location:
Chromosome 3 (position 31567327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTMCTGTAGGTGCGAGCCAGTGCGATYGCTCAAGATGCTGATCAGAACTA[T/G]GACTACGCCTCGAACAGTGTGATYCTGCATCTAGACGCTGGCGATGAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/whye9jqg