hbp1

Ensembl ID:
ENSDARG00000028517
ZFIN ID:
ZDB-GENE-050522-414
Description:
HMG box-containing protein 1 [Source:RefSeq peptide;Acc:NP_001019602]
Human Orthologue:
HBP1
Human Description:
HMG-box transcription factor 1 [Source:HGNC Symbol;Acc:23200]
Mouse Orthologue:
Hbp1
Mouse Description:
high mobility group box transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:894659]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16526 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029067 Nonsense 92 481 3 11
Genomic Location:
Chromosome 25 (position 3522054)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTRTCTCATCACGAGGAAGGGCCCGGCAGYGACTCSCACACAAACTG[G/A]CTGACCGAACTGGCCAACATCGCCACCAGCCCCCAAAGYCCCCTGCTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k1djip09