cited3

Ensembl ID:
ENSDARG00000028514
ZFIN ID:
ZDB-GENE-030425-5
Description:
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 3 [Source:RefSeq pe
Human Orthologue:
CITED4
Human Description:
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4 [Source:HGNC Symbo
Mouse Orthologue:
Cited4
Mouse Description:
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4 Gene [Source:MGI S

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14865 Nonsense Available for shipment Available now
sa28705 Nonsense Mutation detected in F1 DNA During 2016
sa36210 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029413 Nonsense 111 254 2 2
ENSDART00000124900 Nonsense 111 207 2 2
Genomic Location:
Chromosome 16 (position 39509417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCCAGCCAMAGCAGCATCACGTTCAGCAGCATCAACAGCAGCATCAA[C/T]AGCACCACCACATGCAGCARCAAMAGCCTCAACCACCACCGNNNCAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029413 Nonsense 128 254 2 2
ENSDART00000124900 Nonsense 128 207 2 2
Genomic Location:
Chromosome 16 (position 39509468)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACCACCACATGCAGCAACAACAGCCTCAACCACCACCGCCACAACAA[C/T]AACAACAACAACAGCAGCAACAGCAGTATATGACCGGGGGTCTCACTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029413 Nonsense 225 254 2 2
ENSDART00000124900   None 207 None 2
Genomic Location:
Chromosome 16 (position 39509759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAAGAGGTTTTGACGTCGTTGGTCATGGAGCTAGGACTGGACCGGGTG[C/T]AAGAACTCCCTGAACTCTTCCTCGGACAAAACGAGTTTGACTTCATATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link