cited3

Ensembl ID:
ENSDARG00000028514
ZFIN ID:
ZDB-GENE-030425-5
Description:
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 3 [Source:RefSeq pe
Human Orthologue:
CITED4
Human Description:
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4 [Source:HGNC Symbo
Mouse Orthologue:
Cited4
Mouse Description:
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4 Gene [Source:MGI S

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14865 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029413 Nonsense 111 254 2 2
ENSDART00000124900 Nonsense 111 207 2 2
Genomic Location:
Chromosome 16 (position 39509417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCCAGCCAMAGCAGCATCACGTTCAGCAGCATCAACAGCAGCATCAA[C/T]AGCACCACCACATGCAGCARCAAMAGCCTCAACCACCACCGNNNCAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m3a9msiy