itgb4

Ensembl ID:
ENSDARG00000028507
ZFIN ID:
ZDB-GENE-030131-7209
Description:
integrin, beta 4 [Source:RefSeq peptide;Acc:NP_001019557]
Human Orthologue:
ITGB4
Human Description:
integrin, beta 4 [Source:HGNC Symbol;Acc:6158]
Mouse Orthologue:
Itgb4
Mouse Description:
integrin beta 4 Gene [Source:MGI Symbol;Acc:MGI:96613]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14803 Splice Site, Nonsense Available for shipment Available now
sa21220 Nonsense Mutation detected in F1 DNA During 2014
sa18911 Nonsense Mutation detected in F1 DNA During 2014
sa3685 Nonsense Mutation detected in F1 DNA During 2014
sa21221 Nonsense Mutation detected in F1 DNA During 2014
sa18596 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029308 Splice Site, Nonsense 188 1893 7 41

The following transcripts of ENSDARG00000028507 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 13633526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACNTTTTTTATCACACACTCATAATGTAGTWTGTTTTCTSTTTTACAGAT[T/G]AGCTGAGCCGTGGTCCAATAGCGACCCTCCATTTTCCTTCCGTAAMGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029308 Nonsense 766 1893 20 41

The following transcripts of ENSDARG00000028507 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 13644119)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGACAGGTCGTATGGTGGGCTTTAAAGAAAACCAGTACCTGCTACGT[C/T]AGTCTTTTCTGCAAAATGATTATTTGGACACCCCAATGGTGCGCAGCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029308 Nonsense 1064 1893 27 41
ENSDART00000029308 Nonsense 1064 1893 27 41

The following transcripts of ENSDARG00000028507 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 13649364)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGCTATGGAGCAGGTGAAACAGAGAAGATTGTCCCAGTGAAACTTCTG[G/T]AACTTGGAGAGCAAGATGGCCTGCTGGAGGACAAGCAGGTCAAACAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029308 Nonsense 1064 1893 27 41
ENSDART00000029308 Nonsense 1064 1893 27 41

The following transcripts of ENSDARG00000028507 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 13649364)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCTATGGASMAGGTGAAACAGAGAAGATTGTCCCAGTGAAACTTCTG[G/T]AACTTGGAGAGCAAGATGGCCTGCTGGAGGACAARCAGGTCAAACAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029308 Nonsense 1088 1893 27 41

The following transcripts of ENSDARG00000028507 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 13649436)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGAGGACAAGCAGGTCAAACAGTTTGTCATGGATTTGACCAACCCA[C/T]GACAAAGTGCTAAACTAGGCCGTTACCCACGCACTGTTATCACCATCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029308 Nonsense 1227 1893 29 41

The following transcripts of ENSDARG00000028507 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 13652322)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAACATTTCAGGGGATGGTAAAAATCAGGATTTCCAGAAGATGGAMTA[T/G]GTTACTCAAACAGCCACATCCYCCGGAGGACGCCTCTATTCTCCAGCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p1632knv