LOC571285

Ensembl ID:
ENSDARG00000028469
Human Orthologue:
RPS6KA2
Human Description:
ribosomal protein S6 kinase, 90kDa, polypeptide 2 [Source:HGNC Symbol;Acc:10431]
Mouse Orthologue:
Rps6ka2
Mouse Description:
ribosomal protein S6 kinase, polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:1342290]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22234 Nonsense Mutation detected in F1 DNA During 2016
sa42145 Nonsense Mutation detected in F1 DNA During 2016
sa13797 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044705 Nonsense 31 735 1 21
Genomic Location:
Chromosome 13 (position 9496168)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCGTCTACCTTCGGAGAAAGTCGCGGTCCAAAAGCTCGAGTCTATGC[A/T]AACTGGAGGTGGGTGTCACTTGATTTCTGCCGTGTGCCAGCATGTGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044705 Nonsense 88 735 3 21
Genomic Location:
Chromosome 13 (position 9473736)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTTTTCTTAGTGAGAAAAATCAAAGGCTCAGATACAGGACAACTCTA[T/A]GCCATGAAGGTCTTAAAAAAGGCAACACTTAAAGGTAAAAAAAAAGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044705 Nonsense 262 735 9 21
Genomic Location:
Chromosome 13 (position 9452374)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCTGTTTCTGYCTTCAGTTTGAAATGCTGACTGGATCCCTGCCATTT[C/T]AAGGCAAAGACCGCAAAGAGACCATGGCACTTATTCTCAAGTAAGARTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link