LOC571285

Ensembl ID:
ENSDARG00000028469
Human Orthologue:
RPS6KA2
Human Description:
ribosomal protein S6 kinase, 90kDa, polypeptide 2 [Source:HGNC Symbol;Acc:10431]
Mouse Orthologue:
Rps6ka2
Mouse Description:
ribosomal protein S6 kinase, polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:1342290]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22234 Nonsense Mutation detected in F1 DNA During 2014
sa13797 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044705 Nonsense 31 735 1 21
Genomic Location:
Chromosome 13 (position 9496168)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCGTCTACCTTCGGAGAAAGTCGCGGTCCAAAAGCTCGAGTCTATGC[A/T]AACTGGAGGTGGGTGTCACTTGATTTCTGCCGTGTGCCAGCATGTGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044705 Nonsense 262 735 9 21
Genomic Location:
Chromosome 13 (position 9452374)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCTGTTTCTGYCTTCAGTTTGAAATGCTGACTGGATCCCTGCCATTT[C/T]AAGGCAAAGACCGCAAAGAGACCATGGCACTTATTCTCAAGTAAGARTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v9408av0