edem2

Ensembl ID:
ENSDARG00000028448
ZFIN ID:
ZDB-GENE-060519-1
Description:
Edem2 protein [Source:UniProtKB/TrEMBL;Acc:Q7ZVI0]
Human Orthologue:
EDEM2
Human Description:
ER degradation enhancer, mannosidase alpha-like 2 [Source:HGNC Symbol;Acc:15877]
Mouse Orthologue:
Edem2
Mouse Description:
ER degradation enhancer, mannosidase alpha-like 2 Gene [Source:MGI Symbol;Acc:MGI:1915540]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7999 Nonsense Mutation detected in F1 DNA During 2014
sa15242 Nonsense Available for shipment Available now
sa1793 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033774 Nonsense 55 599 1 11
Genomic Location:
Chromosome 23 (position 7094292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTACTTCATGCTTACTTTCCTTTTCTCCGCCATTTTCTGCGCCGCGTA[C/A]CTGTCTCCGATCATCAGTCATGTTAAAGGCAGAGACTTTACTGAGCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033774 Nonsense 91 599 2 11
Genomic Location:
Chromosome 23 (position 7093892)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCACAGGGACAGAGTAAAGTCCATGTTTTATCATGCATATAACAGCTA[T/A]CTGGACAATGCRTATCCATATGATGAGCTGAGGCCGCTGACCTGTGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033774 Nonsense 477 599 11 11
Genomic Location:
Chromosome 23 (position 7062921)
KASP Assay ID:
554-1785.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAACCGCATGGAATCCTTCTTCCTAGCCGAGACCATTAAATACCTCTA[C/A]CTCCTCTTCGATCCTGACAACTTCCTTCACAACACGGGCACAGAGTTTGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gk2cr7je