adnp2b

Ensembl ID:
ENSDARG00000028431
ZFIN ID:
ZDB-GENE-030131-5930
Description:
ADNP homeobox 2b [Source:RefSeq peptide;Acc:NP_001073482]
Human Orthologue:
ADNP2
Human Description:
ADNP homeobox 2 [Source:HGNC Symbol;Acc:23803]
Mouse Orthologue:
Adnp2
Mouse Description:
ADNP homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2448562]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11258 Nonsense Available for shipment Available now
sa1306 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038942 Nonsense 467 947 4 4
Genomic Location:
Chromosome 19 (position 21272348)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCACAATTGCCTCCATCCCAGAACAATCCAGCTGCTCAGCAAAACAAA[C/T]AAAGCAGCGGCTTATMGACCCCCAAGCAAACCAAGAAGTGGATCACATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038942 Nonsense 472 947 4 4
Genomic Location:
Chromosome 19 (position 21272364)
KASP Assay ID:
554-1221.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCCAGAACAATCCAGCTGCTCAGCAAAACAAACAAAGCAGCGGCTTAT[C/A]GACCCCCAAGCAAACCAAGAAGTGGATCACATGCCCTATTTGTAATGAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l1xsqt8l