fkbp5

Ensembl ID:
ENSDARG00000028396
ZFIN ID:
ZDB-GENE-030616-630
Description:
peptidyl-prolyl cis-trans isomerase FKBP5 [Source:RefSeq peptide;Acc:NP_998314]
Human Orthologue:
FKBP5
Human Description:
FK506 binding protein 5 [Source:HGNC Symbol;Acc:3721]
Mouse Orthologue:
Fkbp5
Mouse Description:
FK506 binding protein 5 Gene [Source:MGI Symbol;Acc:MGI:104670]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12885 Essential Splice Site Available for shipment Available now
sa15952 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028373 Essential Splice Site 280 453 8 11

The following transcripts of ENSDARG00000028396 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 41041324)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYTGGAACGTGCKGTTTTAGTCAAACAAAAAGGGACACAGTATTTCAAGG[T/A]TCGTCTACACTTTTATCTTGGCATTTATTCTAGTTGCTAWMTTTAATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028373 Nonsense 283 453 9 11

The following transcripts of ENSDARG00000028396 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 41042568)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCAGTCGTCAAACTGACATTTTGTTTACACTGTCCACTCAGGCAGGA[C/T]GATACAACTATGCTGTAATTCAGTACCAGCGGATCGTAAACTGGTTGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nq6v8346