DAAM2

Ensembl ID:
ENSDARG00000028393
Description:
dishevelled associated activator of morphogenesis 2 [Source:HGNC Symbol;Acc:18143]
Human Orthologue:
DAAM2
Human Description:
dishevelled associated activator of morphogenesis 2 [Source:HGNC Symbol;Acc:18143]
Mouse Orthologue:
Daam2
Mouse Description:
dishevelled associated activator of morphogenesis 2 Gene [Source:MGI Symbol;Acc:MGI:1923691]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11626 Nonsense Available for shipment Available now
sa23181 Nonsense Available for shipment Available now
sa36524 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23182 Essential Splice Site Available for shipment Available now
sa23183 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034563 Nonsense 114 1092 3 30
Genomic Location (Zv9):
Chromosome 17 (position 48999869)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48761667
GRCz11 17 48844296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGAACAAGAGGACCCCAACAAACTTGCCACCAGCTGGCCTGATTACTA[T/A]ATAGATCGGATCAACTCCATGGCAGCTGTAAGTATTTACTTTGTTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034563 Nonsense 376 1092 9 30
Genomic Location (Zv9):
Chromosome 17 (position 49010343)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48772141
GRCz11 17 48854770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGATGCATGTGGATACTAAGAGTGCTGGCCAGATGTTTGAACTGATC[A/T]AGAAGAAACTGAGCCATACAGATGCCTACCCCCACCTTCTATCTATCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034563 Essential Splice Site 743 1092 23 30
Genomic Location (Zv9):
Chromosome 17 (position 49029798)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48791304
GRCz11 17 48873933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATAAGCAAATGCTCTGCACGTGTAAATGTTTGTTGGTTTTATTTTAC[A/T]GCTGCTTAAGTTTGTTCCTGAAAAAAGTGATATGGACCTTCTGGAGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034563 Essential Splice Site 864 1092 25 30
Genomic Location (Zv9):
Chromosome 17 (position 49039326)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48800832
GRCz11 17 48883461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTGTCCAGTCTTAACAAGATCATAGACACCAAGTCAAGTATAGACAG[G/A]TCAGGAGTCATCGAAAATGGTTTTATTAGCTTGCTCATCCAAATGCAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034563 Nonsense 1067 1092 30 30
Genomic Location (Zv9):
Chromosome 17 (position 49048566)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48810072
GRCz11 17 48892701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTGTCAGCTCTTCGCTCAGGTGAAGTCTTCGACAAGGACTCTAAACTT[A/T]AACGCAACCGCAAGCGCTCTGTAAACCAGTTGGCTGATGCCGGAGGTCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link