htatip2

Ensembl ID:
ENSDARG00000028386
ZFIN ID:
ZDB-GENE-001219-1
Description:
oxidoreductase HTATIP2 [Source:RefSeq peptide;Acc:NP_571756]
Human Orthologue:
HTATIP2
Human Description:
HIV-1 Tat interactive protein 2, 30kDa [Source:HGNC Symbol;Acc:16637]
Mouse Orthologue:
Htatip2
Mouse Description:
HIV-1 tat interactive protein 2, homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1859271]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5403 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa5403
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035558 Essential Splice Site 164 236 None 6
ENSDART00000132706   None 137 None 3
ENSDART00000145357 Essential Splice Site 164 236 None 6

The following transcripts of ENSDARG00000028386 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 17877922)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16850711
KASP Assay ID:
554-3585.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAGCCCTACATCATTTRATCTCTAGYTTATATGTGTTTGTTWATTTCT[A/C]GGGTGCTRTTAGTGGACAGACAGGAGAGCCGGCCTTCAGAGTGGATGGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link