pax3b

Ensembl ID:
ENSDARG00000028348
ZFIN ID:
ZDB-GENE-080917-53
Description:
Paired box protein 3b [Source:UniProtKB/TrEMBL;Acc:C0M006]
Human Orthologue:
PAX3
Human Description:
paired box 3 [Source:HGNC Symbol;Acc:8617]
Mouse Orthologue:
Pax3
Mouse Description:
paired box gene 3 Gene [Source:MGI Symbol;Acc:MGI:97487]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12874 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015843 Essential Splice Site 274 480 5 10
Genomic Location (Zv9):
Chromosome 15 (position 40704693)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42221482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAGAAGAGCTCGCACAGAGAGCCAAACTYACAGAGGCACGAGTACAG[G/A]TACATCYGCACCCATATWTACCTTAAAWTGCAAAAATGCAGACAGACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Facial morphology: Genome-wide association study of three-dimensional facial morphology identifies a variant in PAX3 associated with nasion position. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link