dhdhl

Ensembl ID:
ENSDARG00000028336
ZFIN ID:
ZDB-GENE-040426-2180
Description:
dihydrodiol dehydrogenase (dimeric), like [Source:RefSeq peptide;Acc:NP_999900]
Human Orthologue:
DHDH
Human Description:
dihydrodiol dehydrogenase (dimeric) [Source:HGNC Symbol;Acc:17887]
Mouse Orthologue:
Dhdh
Mouse Description:
dihydrodiol dehydrogenase (dimeric) Gene [Source:MGI Symbol;Acc:MGI:1919005]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28950 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032392 Nonsense 166 334 4 7
Genomic Location (Zv9):
Chromosome 18 (position 773714)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 1081651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTAAGTGTGTATTTCGGTCTGAATCTCCTGGACCGCATACACACCACC[C/T]AGAAGGAGCAGGGTGGAGGATCTCTGCTGTACATCGGCGTCTACTGCGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link