gmfb

Ensembl ID:
ENSDARG00000028327
ZFIN ID:
ZDB-GENE-040426-2114
Description:
glia maturation factor beta [Source:RefSeq peptide;Acc:NP_998275]
Human Orthologue:
GMFB
Human Description:
glia maturation factor, beta [Source:HGNC Symbol;Acc:4373]
Mouse Orthologue:
Gmfb
Mouse Description:
glia maturation factor, beta Gene [Source:MGI Symbol;Acc:MGI:1927133]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6324 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030211 Essential Splice Site 119 142 6 7

The following transcripts of ENSDARG00000028327 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 36991687)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36463989
KASP Assay ID:
554-4507.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATGCTGGCAGCAAAAACAAACTGGTACAGACAGTTGAACTGACCAAG[G/A]TGAGTACAAATAAAGTTTCTTTAAGACAAGTCATTTCACTCAGCGGCCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link