mybbp1a

Ensembl ID:
ENSDARG00000028323
ZFIN ID:
ZDB-GENE-030131-9864
Description:
Myb-binding protein 1A-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q6DRL5]
Human Orthologue:
MYBBP1A
Human Description:
MYB binding protein (P160) 1a [Source:HGNC Symbol;Acc:7546]
Mouse Orthologue:
Mybbp1a
Mouse Description:
MYB binding protein (P160) 1a Gene [Source:MGI Symbol;Acc:MGI:106181]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44599 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14338 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038767 Essential Splice Site 533 1141 12 25
ENSDART00000097189 Essential Splice Site 533 625 12 15
ENSDART00000136619 Essential Splice Site 532 1140 11 24
Genomic Location (Zv9):
Chromosome 5 (position 8987582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGCATGGAGAAAGCTCAGGCTAAGAAATCCAAAAAGAAGAAAGCAAG[T/A]GAGTTTAAGCCATTCTCTGCAGTTAAAGACTGCTGTTTTAGATTTGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038767 Nonsense 818 1141 18 25
ENSDART00000097189   None 625 None 15
ENSDART00000136619 Nonsense 817 1140 17 24
Genomic Location (Zv9):
Chromosome 5 (position 8998647)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8219836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACGGCCGAGAGGCRGAACTTCATGAAATGCTGGAGCGTCTGATTGGC[C/T]GAGCCCAGAAACTGACAGACTCATCTGTGGCTTTGTACTACTTTAGGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link