mybbp1a

Ensembl ID:
ENSDARG00000028323
ZFIN ID:
ZDB-GENE-030131-9864
Description:
Myb-binding protein 1A-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q6DRL5]
Human Orthologue:
MYBBP1A
Human Description:
MYB binding protein (P160) 1a [Source:HGNC Symbol;Acc:7546]
Mouse Orthologue:
Mybbp1a
Mouse Description:
MYB binding protein (P160) 1a Gene [Source:MGI Symbol;Acc:MGI:106181]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14338 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038767 Nonsense 818 1141 18 25
ENSDART00000097189 None None 625 None 15
ENSDART00000136619 Nonsense 817 1140 17 24
Genomic Location:
Chromosome 5 (position 8998647)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACGGCCGAGAGGCRGAACTTCATGAAATGCTGGAGCGTCTGATTGGC[C/T]GAGCCCAGAAACTGACAGACTCATCTGTGGCTTTGTACTACTTTAGGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ydqo630i