pex14

Ensembl ID:
ENSDARG00000028322
ZFIN ID:
ZDB-GENE-060130-169
Human Orthologue:
PEX14
Human Description:
peroxisomal biogenesis factor 14 [Source:HGNC Symbol;Acc:8856]
Mouse Orthologue:
Pex14
Mouse Description:
peroxisomal biogenesis factor 14 Gene [Source:MGI Symbol;Acc:MGI:1927868]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14078 Essential Splice Site Available for shipment Available now
sa13868 Essential Splice Site Available for shipment Available now
sa44004 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078171 Essential Splice Site 191 377 7 9
ENSDART00000134121 Essential Splice Site 237 423 8 10
ENSDART00000078171 Essential Splice Site 191 377 7 9
ENSDART00000134121 Essential Splice Site 237 423 8 10
Genomic Location (Zv9):
Chromosome 23 (position 29148417)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28978984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACAGAAGAAAATACAGGAGCTGACACAAGAGCTGGCTAACTCACAGG[T/C]ACGCACACACACATTYGMCACAATGGACACATTGAYGAAAATTCTGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078171 Essential Splice Site 191 377 7 9
ENSDART00000134121 Essential Splice Site 237 423 8 10
ENSDART00000078171 Essential Splice Site 191 377 7 9
ENSDART00000134121 Essential Splice Site 237 423 8 10
Genomic Location (Zv9):
Chromosome 23 (position 29148417)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28978984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACAGAAGAAAATACAGGAGCTGACACAAGAGCTGGCTAACTCACAGG[T/C]ACGCACACACACATTYGMCACAATGGACACATTGAYGAAAATTCTGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078171 Nonsense 216 377 8 9
ENSDART00000134121 Nonsense 262 423 9 10
Genomic Location (Zv9):
Chromosome 23 (position 29162074)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28992641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGAGTCTCAGAGCATCAGTGAACTCAAGGCTGAGATTGTGTCTCTT[A/T]AGGGTCTTCTCCTCAGCAGGTAACTGTTTTCAATGATTAATCAACAATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link