si:ch73-237c6.4

Ensembl ID:
ENSDARG00000028295
ZFIN ID:
ZDB-GENE-030131-5954
Description:
hypothetical protein LOC559882 [Source:RefSeq peptide;Acc:NP_001121808]
Human Orthologues:
MKRN1, MKRN3
Human Descriptions:
makorin ring finger protein 1 [Source:HGNC Symbol;Acc:7112]
makorin ring finger protein 3 [Source:HGNC Symbol;Acc:7114]
Mouse Orthologues:
Mkrn1, Mkrn3
Mouse Descriptions:
makorin, ring finger protein, 1 Gene [Source:MGI Symbol;Acc:MGI:1859353]
makorin, ring finger protein, 3 Gene [Source:MGI Symbol;Acc:MGI:2181178]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27197 Nonsense Mutation detected in F1 DNA During 2017
sa16544 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104346 Nonsense 27 397 2 8
ENSDART00000132734 Nonsense 32 161 2 3
ENSDART00000142395 Nonsense 17 161 1 3
Genomic Location (Zv9):
Chromosome 8 (position 24579751)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23705569
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGGATTTGTTGTTGCTCTTTTGCAGGCAGTTCATCAATGGATCGTGT[C/T]GATATGGTCAAAGTTGTTACTACCTACACGAGTTTCCTTCAGTTCCGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104346 Nonsense 250 397 5 8
ENSDART00000132734   None 161 None 3
ENSDART00000142395   None 161 None 3
Genomic Location (Zv9):
Chromosome 8 (position 24581197)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23707015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTGGCATCTGCATGGACAAGATTTCTGAGAAATCCACCGCTCAGGAA[C/T]GACGTTRCGGCATCCTACCCAACTGCAATCATGCTTTCTGCATTGGCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link