LOC562017

Ensembl ID:
ENSDARG00000028276
Human Orthologues:
RGS16, RGS4, RGS5, RGS8
Human Descriptions:
regulator of G-protein signaling 16 [Source:HGNC Symbol;Acc:9997]
regulator of G-protein signaling 4 [Source:HGNC Symbol;Acc:10000]
regulator of G-protein signaling 5 [Source:HGNC Symbol;Acc:10001]
regulator of G-protein signaling 8 [Source:HGNC Symbol;Acc:16810]
Mouse Orthologues:
Rgs16, Rgs4, Rgs5, Rgs8
Mouse Descriptions:
regulator of G-protein signaling 16 Gene [Source:MGI Symbol;Acc:MGI:108407]
regulator of G-protein signaling 4 Gene [Source:MGI Symbol;Acc:MGI:108409]
regulator of G-protein signaling 5 Gene [Source:MGI Symbol;Acc:MGI:1098434]
regulator of G-protein signaling 8 Gene [Source:MGI Symbol;Acc:MGI:108408]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15835 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15835
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037250 Essential Splice Site 34 155 2 5
Genomic Location:
Chromosome 1 (position 55542229)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGAGGGTCAAACTCTCCCACCTGGCCGAAAAACAGGACAAACACAGG[T/A]AACACAACWGCACCGACTAYTCCCATTGAAAGGGGTCATATCACACCGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eecit8je