aldh3a2

Ensembl ID:
ENSDARG00000028259
ZFIN ID:
ZDB-GENE-040718-74
Description:
fatty aldehyde dehydrogenase [Source:RefSeq peptide;Acc:NP_997814]
Human Orthologues:
ALDH3A1, ALDH3A2
Human Descriptions:
aldehyde dehydrogenase 3 family, member A1 [Source:HGNC Symbol;Acc:405]
aldehyde dehydrogenase 3 family, member A2 [Source:HGNC Symbol;Acc:403]
Mouse Orthologues:
Aldh3a1, Aldh3a2
Mouse Descriptions:
aldehyde dehydrogenase family 3, subfamily A1 Gene [Source:MGI Symbol;Acc:MGI:1353451]
aldehyde dehydrogenase family 3, subfamily A2 Gene [Source:MGI Symbol;Acc:MGI:1353452]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35869 Nonsense Mutation detected in F1 DNA During 2016
sa5879 Nonsense Mutation detected in F1 DNA During 2016
sa18111 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031625 Nonsense 29 488 2 11
ENSDART00000133948 Nonsense 29 116 2 3
ENSDART00000141746 Nonsense 29 195 2 5

The following transcripts of ENSDARG00000028259 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 19799933)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20902559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGGCGTTCTTGACCGGAAGATCCAAATCCCTGGACTACAGAATCAAA[C/T]AACTTAAAAACCTAAGTCGATTCATTAAAGAAAGAGCAGCAGACATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031625 Nonsense 248 488 6 11
ENSDART00000133948   None 116 None 3
ENSDART00000141746   None 195 None 5

The following transcripts of ENSDARG00000028259 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 19797614)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20900240
KASP Assay ID:
554-3665.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGGGGAAAGTATTTGAACTGCGGTCAGACCTGCATTGCTCCTGATTA[C/A]ATCCTCTGTGAATCCAGCATCCAAGACAGAGTCATCGATGAGATCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031625 Nonsense 439 488 10 11
ENSDART00000133948   None 116 None 3
ENSDART00000141746   None 195 None 5

The following transcripts of ENSDARG00000028259 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 19794451)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20897077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACCTTCGCAGCTGTCTTATTAAGAARCTGAACATGGAGGCAGTGAAT[C/T]AGATGCGCTACCCGCCCCATACAACTGAGAAGTTACGCTGGGCCCGTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link