aldh3a2

Ensembl ID:
ENSDARG00000028259
ZFIN ID:
ZDB-GENE-040718-74
Description:
fatty aldehyde dehydrogenase [Source:RefSeq peptide;Acc:NP_997814]
Human Orthologues:
ALDH3A1, ALDH3A2
Human Descriptions:
aldehyde dehydrogenase 3 family, member A1 [Source:HGNC Symbol;Acc:405]
aldehyde dehydrogenase 3 family, member A2 [Source:HGNC Symbol;Acc:403]
Mouse Orthologues:
Aldh3a1, Aldh3a2
Mouse Descriptions:
aldehyde dehydrogenase family 3, subfamily A1 Gene [Source:MGI Symbol;Acc:MGI:1353451]
aldehyde dehydrogenase family 3, subfamily A2 Gene [Source:MGI Symbol;Acc:MGI:1353452]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5879 Nonsense Mutation detected in F1 DNA During 2014
sa18111 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031625 Nonsense 248 488 6 11
ENSDART00000133948 None None 116 None 3
ENSDART00000141746 None None 195 None 5

The following transcripts of ENSDARG00000028259 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 19797614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGGGGAAAGTATTTGAACTGCGGTCAGACCTGCATTGCTCCTGATTA[C/A]ATCCTCTGTGAATCCAGCATCCAAGACAGAGTCATCGATGAGATCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031625 Nonsense 439 488 10 11
ENSDART00000133948 None None 116 None 3
ENSDART00000141746 None None 195 None 5

The following transcripts of ENSDARG00000028259 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 19794451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACCTTCGCAGCTGTCTTATTAAGAARCTGAACATGGAGGCAGTGAAT[C/T]AGATGCGCTACCCGCCCCATACAACTGAGAAGTTACGCTGGGCCCGTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gwgrz280