si:ch211-233f10.5

Ensembl ID:
ENSDARG00000028236
ZFIN IDs:
ZDB-GENE-060526-119, ZDB-GENE-100119-2
Description:
Collagen alpha-1(XXVII) chain B [Source:UniProtKB/Swiss-Prot;Acc:A0MSJ1]
Human Orthologue:
COL27A1
Human Description:
collagen, type XXVII, alpha 1 [Source:HGNC Symbol;Acc:22986]
Mouse Orthologue:
Col27a1
Mouse Description:
collagen, type XXVII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2672118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14233 Essential Splice Site Available for shipment Available now
sa31484 Essential Splice Site Available for shipment Available now
sa9794 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14233
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097297 Essential Splice Site 753 1619 22 59
ENSDART00000137363 Essential Splice Site 281 1083 17 51
Genomic Location (Zv9):
Chromosome 5 (position 67734406)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64536047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGGGAGAGCCTGGAATGAYTGGAAATCCTGGGATGCTTGGTGAGAGGG[T/C]AAAGGATTTGATGGATTTTTGGTATAKTAGTTAACACTTTTAATCTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097297 Essential Splice Site 1017 1619 36 59
ENSDART00000137363 Essential Splice Site 519 1083 31 51
Genomic Location (Zv9):
Chromosome 5 (position 67705418)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64507059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGGCAAAATAGGGAAAACTGGTGAGAGGGGAAAACCTGGAGAGAAGG[T/C]ATTTTATGTTTGCTTGACATTTTAATTTACAAGCTTTACCAGTTTTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097297 Essential Splice Site 1108 1619 40 59
ENSDART00000137363 Essential Splice Site 610 1083 35 51
Genomic Location (Zv9):
Chromosome 5 (position 67703300)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64504941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCRATGACGGGAAGGTTGAAGGTCYACCTGGTCCTTCTRGTGACATC[G/A]TGAGTCAGTCCATTAAATATATTTTAACTTAGTTTTGGAGAATATYGGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link