ttna

Ensembl ID:
ENSDARG00000028213
ZFIN ID:
ZDB-GENE-030113-2
Description:
Novel protein similar to H.sapiens TTN, titin (TTN) [Source:UniProtKB/TrEMBL;Acc:B0S757]
Human Orthologue:
TTN
Human Description:
titin [Source:HGNC Symbol;Acc:12403]
Mouse Orthologue:
Ttn
Mouse Description:
titin Gene [Source:MGI Symbol;Acc:MGI:98864]

Alleles

There are 94 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18062 Nonsense Available for shipment Available now
sa21585 Nonsense Available for shipment Available now
sa2497 Nonsense Available for shipment Available now
sa34748 Nonsense Mutation detected in F1 DNA During 2016
sa21584 Nonsense Mutation detected in F1 DNA During 2016
sa12924 Nonsense Available for shipment Available now
sa38761 Nonsense Mutation detected in F1 DNA During 2016
sa21583 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5564 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11451 Nonsense Available for shipment Available now
sa41540 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21582 Nonsense Available for shipment Available now
sa8604 Nonsense Mutation detected in F1 DNA During 2016
sa9790 Nonsense Available for shipment Available now
sa34747 Nonsense Mutation detected in F1 DNA During 2016
sa41539 Nonsense Mutation detected in F1 DNA During 2016
sa34746 Nonsense Mutation detected in F1 DNA During 2016
sa31747 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14817 Nonsense Available for shipment Available now
sa30647 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5563 Nonsense Mutation detected in F1 DNA During 2016
sa21581 Nonsense Available for shipment Available now
sa21580 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16898 Nonsense Available for shipment Available now
sa15104 Essential Splice Site Available for shipment Available now
sa8690 Nonsense Mutation detected in F1 DNA During 2016
sa41538 Nonsense Mutation detected in F1 DNA During 2016
sa21579 Nonsense Mutation detected in F1 DNA During 2016
sa12471 Nonsense Available for shipment Available now
sa41537 Nonsense Mutation detected in F1 DNA During 2016
sa34745 Nonsense Mutation detected in F1 DNA During 2016
sa17286 Essential Splice Site Available for shipment Available now
sa41536 Nonsense Mutation detected in F1 DNA During 2016
sa41535 Nonsense Mutation detected in F1 DNA During 2016
sa21578 Nonsense Mutation detected in F1 DNA During 2016
sa12350 Nonsense Available for shipment Available now
sa41534 Essential Splice Site Mutation detected in F1 DNA During 2016
sa30925 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31746 Nonsense Mutation detected in F1 DNA During 2016
sa38760 Nonsense Mutation detected in F1 DNA During 2016
sa10365 Nonsense Available for shipment Available now
sa31745 Nonsense Mutation detected in F1 DNA During 2016
sa14025 Nonsense Available for shipment Available now
sa21577 Nonsense Mutation detected in F1 DNA During 2016
sa34744 Nonsense Mutation detected in F1 DNA During 2016
sa41533 Nonsense Mutation detected in F1 DNA During 2016
sa41532 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41531 Nonsense Mutation detected in F1 DNA During 2016
sa1736 Nonsense Available for shipment Available now
sa41530 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34743 Nonsense Mutation detected in F1 DNA During 2016
sa8355 Nonsense Mutation detected in F1 DNA During 2016
sa8574 Nonsense Mutation detected in F1 DNA During 2016
sa2512 Nonsense F2 line generated During 2016
sa21576 Nonsense Mutation detected in F1 DNA During 2016
sa1029 Nonsense Confirmed mutation in F2 line During 2016
sa21575 Nonsense Available for shipment Available now
sa21574 Nonsense Available for shipment Available now
sa18965 Nonsense Mutation detected in F1 DNA During 2016
sa15885 Essential Splice Site Available for shipment Available now
sa34742 Nonsense Mutation detected in F1 DNA During 2016
sa9067 Nonsense Mutation detected in F1 DNA During 2016
sa18964 Nonsense Mutation detected in F1 DNA During 2016
sa5565 Nonsense Mutation detected in F1 DNA During 2016
sa11772 Nonsense Available for shipment Available now
sa41529 Nonsense Mutation detected in F1 DNA During 2016
sa16825 Nonsense Available for shipment Available now
sa13049 Nonsense Available for shipment Available now
sa41528 Nonsense Mutation detected in F1 DNA During 2016
sa16217 Nonsense Available for shipment Available now
sa34741 Nonsense Mutation detected in F1 DNA During 2016
sa41527 Nonsense Mutation detected in F1 DNA During 2016
sa12872 Nonsense Available for shipment Available now
sa13884 Nonsense Available for shipment Available now
sa21573 Nonsense Available for shipment Available now
sa787 Nonsense Available for shipment Available now
sa14565 Nonsense Available for shipment Available now
sa13739 Nonsense Available for shipment Available now
sa34740 Nonsense Mutation detected in F1 DNA During 2016
sa15087 Nonsense Available for shipment Available now
sa2493 Nonsense Available for shipment Available now
sa3705 Nonsense Mutation detected in F1 DNA During 2016
sa21572 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12142 Nonsense Available for shipment Available now
sa2492 Nonsense F2 line generated During 2016
sa38759 Nonsense Mutation detected in F1 DNA During 2016
sa1712 Nonsense Available for shipment Available now
sa30924 Nonsense Mutation detected in F1 DNA During 2016
sa41526 Nonsense Mutation detected in F1 DNA During 2016
sa12712 Essential Splice Site Available for shipment Available now
sa25437 Nonsense Mutation detected in F1 DNA During 2016
sa21571 Nonsense Available for shipment Available now
sa41525 Nonsense Mutation detected in F1 DNA During 2016
sa41524 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18062
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 269 7601 5 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 269 7601 6 75
ENSDART00000109099 Nonsense 269 31319 5 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44139746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTCCACCTCGTGTGCCTCCTAAGCCAACCTCAAAATCTCCACCTTCA[C/T]AACTGACTAAAGTTTCAACTGCTCGCCAACAGTCTCCCTCTCCTGTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 429 31319 8 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44135989)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTAAGCAACAATTTAGAGGTTTCTTTCCACATGTTCATAGATATCATG[T/A]CAGGGAATCCAGGAGAAATCTGTGACAACTCAAACTTTGACAACTCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2497
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 786 7601 12 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 786 7601 13 75
ENSDART00000109099 Nonsense 1179 31319 20 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44126752)
KASP Assay ID:
554-2866.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCTATGTGGAGTCCACTGCTGCTGCTCAGCCTTACTATCCTCAGGCT[G/T]AAGCTGTGAGGAGAGTCCAGTGAGTTTTCTTYACCTTACCAAGCTTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 869 7601 13 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 869 7601 14 75
ENSDART00000109099 Nonsense 1262 31319 21 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44126401)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGGTTTGACTTAAAAGTAGTTGGAAGACCTATGCCCGACACTTTCTG[G/A]TTCCACAGTGGTAAGTGTGTTTCAGAGCTGTTCCACCATTCCAAAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 1192 7601 16 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 1192 7601 17 75
ENSDART00000109099 Nonsense 1585 31319 24 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44125142)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGAAGAGTCTGGTAGAGGACAGTCAATTACCAGAAGGAAGAAAGGTA[C/T]AAAGAATGGATGAAATGGAGAGAATTGCCCATGAGGGTGGACCCTCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12924
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 1227 7601 16 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 1227 7601 17 75
ENSDART00000109099 Nonsense 1620 31319 24 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44125037)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGGATGACATGTCTGAGAAGTCCAAGCCAGAGATTGTCTTACTCCCT[G/T]AACCAATAAGAGTATTTGAAGGCGAGACAGCCAAATATCGATGCAGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 1507 7601 16 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 1507 7601 17 75
ENSDART00000109099 Nonsense 1900 31319 24 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44124195)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTTAAAAATGGCATTTTACTTGAGAAGTCAGATCGGGTTTATTGGTA[T/A]TGGCCTGAAGATCATGTCTGTGAATTAGTAATCAGAGATGTCTTAGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Essential Splice Site 1550 7601 16 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Essential Splice Site 1550 7601 17 75
ENSDART00000109099 Essential Splice Site 1943 31319 24 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44124066)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAACATTGCCGGTGAGGCCTCAAGCCATGCCTTCTTGTTGGTGCAAGG[T/G]AAGTATTGTTATGTTTAAATCAGTCTTACGCTAATGATCAATATTACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Essential Splice Site 1912 7601 20 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Essential Splice Site 1912 7601 21 75
ENSDART00000109099 Essential Splice Site 2305 31319 28 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44122612)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATGGCTGTGGGCAGAGTTGAAACCACTTGTAACCTGACAGTTGAGAG[T/A]GAGTTTTTTAAAAAWATATATATAAATGAAACCAAATTGCACATCATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 2048 7601 22 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 2048 7601 23 75
ENSDART00000109099 Nonsense 2441 31319 30 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44122030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGCTTAAGGATGGCCACTCTGTTGACTTCAGTGATATTGTCAGGAGT[G/T]AGGATATAGATGCTGTCCGTCGACTTATTTTTGTTATCACAAGAYCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Essential Splice Site 2347 7601 25 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Essential Splice Site 2347 7601 26 75
ENSDART00000109099 Essential Splice Site 2740 31319 33 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44120873)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTTTGTGTGTGGAAATGACAAAGTCTCAGCCACCTTGACAGTCAGCC[G/T]TAAGTTCATTTTTATTTGATTTTTTAATGCAAAATTGTTTACCTGGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 2483 7601 28 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 2483 7601 29 75
ENSDART00000109099 Nonsense 2876 31319 36 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44120129)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATTAAAAGTAGCATCCTGATGGATACATAATCTTCACGTTTTAGGTA[C/A]AAGGTCTCCACAGAGAGACACGTGCATCGTCTCATGATCCAAACTGTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 2689 7601 30 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 2689 7601 31 75
ENSDART00000109099 Nonsense 3082 31319 38 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44119157)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAATGAGCAYACATTGCTGCTCATCGAAGTCTTCCCWGAAGATGCAGCT[C/T]AGTATAACTGTGAAGCTAAGAATGACTATGGAGTTGCCACAAGCTCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 2947 7601 34 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 2947 7601 35 75
ENSDART00000109099 Nonsense 3470 31319 43 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44105613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGAGAGATGAATACTCTTTAATAATAACAAAAGTCAAGAAAGATTA[T/A]GAAGGAGAGTATTCTTGTACTGCAAGTAATAGATTTGGCCAGACTACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34747
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 3329 7601 34 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 3329 7601 35 75
ENSDART00000109099 Nonsense 3852 31319 43 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44104469)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAGAGGGAGTTAAAATTCTTTACAGTGCAGTTTCATCAGAGAAACAA[C/T]AGTTTACAGAGGGTCACTCTAAAGAACTATCAACAGAAGAACCAACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41539
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 3353 7601 34 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 3353 7601 35 75
ENSDART00000109099 Nonsense 3876 31319 43 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44104397)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAACTATCAACAGAAGAACCAACTTTTCAGACATCGGTGAAAAAAGAA[C/T]AACACAAACCGGTTGTACTTTCAGTTAATGAGACAACTCAGACCTTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 3803 7601 34 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 3803 7601 35 75
ENSDART00000109099 Nonsense 4326 31319 43 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44103045)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCATGAGGTAAAAGTAAGGAAAGAACCCAAATATCTCATGTTCACTTA[T/A]CTTATTACAAGTGCAAGTGCTCCACTTGAAATTACAATTGCATTTGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31747
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Essential Splice Site 4090 7601 34 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Essential Splice Site 4090 7601 35 75
ENSDART00000109099 Essential Splice Site 4613 31319 43 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44102184)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGCTGGCAAGACCTCTACATCGTCCCACCTCACTGTGATCCCAAGAGG[T/C]TGGAATTATGGGAATATTTTGTCATCCCATCCCACATGACTAACTCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14817
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 4203 7601 36 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 4203 7601 37 75
ENSDART00000109099 Nonsense 4726 31319 45 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44100795)
KASP Assay ID:
2260-2414.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCAGAATTTGTAWCAAAGCCTGATTCGATGACTTTATTTGTTGGCAAG[C/T]AGGCAAAATTTCAATGTGTTATTTCTGGTTCTGAGCCAATGAATGTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Essential Splice Site 4651 7601 39 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Essential Splice Site 4651 7601 40 75
ENSDART00000109099 Essential Splice Site 5174 31319 48 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44099004)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAATGAGGCTGGAAAACAAAAATGTGAGGCCACTGTAACAGTTCAAG[G/A]TTAGAATTTTAATACTGTTTTATTATGAAATACTTTATCATTATTATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 4698 7601 40 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 4698 7601 41 75
ENSDART00000109099 Nonsense 5221 31319 49 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44098770)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATCTCAAAGTTAAATGGTTTAAAGATGGCAAAGAGATGGCAGGGGGT[C/T]GAAAGTACAAAATCACTTTCAAAGAGAATGTGGCCGTCTTGAAAATCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 4700 7601 40 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 4700 7601 41 75
ENSDART00000109099 Nonsense 5223 31319 49 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44098762)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTTAAATGGTTTAAAGATGGCAAAGAGATGGCAGGGGGTCGAAAGTA[C/A]AAAATCACTTTCAAAGAGAATGTGGCCGTCTTGAAAATCCTCTCGGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21580
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Essential Splice Site 6071 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Essential Splice Site 6071 7601 None 75
ENSDART00000109099 Essential Splice Site 6559 31319 None 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44092358)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAATGATGCTGGGACTAAGAGTTGTAGTACAGCTCTCACAATCAAAGG[T/C]TAGATAGTGGAAGAACATTTTATTTACTAGTTTATTATGAGCATTGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 6143 7601 56 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 6143 7601 57 75
ENSDART00000109099 Nonsense 6631 31319 64 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44091746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCAACTCTCCACATTCTCGGACTGGAAGCATCAGATGCTGGAGAATA[T/G]GAGTGCAAARCAACAAATAATGTTGGAAGTGATTTGTGCCAAGGCTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Essential Splice Site 6164 7601 56 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Essential Splice Site 6164 7601 57 75
ENSDART00000109099 Essential Splice Site 6652 31319 64 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44091683)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAATAATGTTGGAAGTGATTTGTGCCAAGGCTCTGTAAAGCTACGAGG[T/C]CAGTAAGATAGCAGTTCAAASTATGGAAWAATTTTCCAACAAWTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 6360 7601 59 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 6360 7601 60 75
ENSDART00000109099 Nonsense 6848 31319 67 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44090829)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTATTCTGTTTTTTGTCGAACAGACAAAATTGTCCCKCCTTTGTTCWCA[C/T]GAAAATTGAAAGATACRCAGAGTATTGTTGGAAAATCTATGGAATTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 6499 7601 60 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 6499 7601 61 75
ENSDART00000109099 Nonsense 6987 31319 68 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44090317)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTAGAGGCAGTAAGGAAATAGTGTCTGGAAGAAGCTGTGAGATTGCGT[T/A]AAGAGGAGATACTGCAATTCTGGAGCTCCACAACATTGACAAATCTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591 Nonsense 7472 7601 72 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460 Nonsense 7472 7601 73 75
ENSDART00000109099 Nonsense 7949 31319 80 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44080563)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAAGCTTTTAGAGCCTCACAGCAGATATACATGTGCTGTGGCCAATTA[C/A]ACTCAGAAGCTCTCAATCAAAGATGTTAGGCCAGAAGATCAAGGAGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 8734 31319 93 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44071747)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCACCTTCTCCTAAAAAGGATGACATAGTACCTCAAAAGATTCCTAAA[C/T]AAGATATATCTCAGACTAAGCCTCATATGAAAGAGATGATTCCCACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41537
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 8989 31319 95 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44070263)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTACAGAGGGAAATTTAATCAAGAAAGATAGAGATGGAAAATTACCT[C/T]AAAAAAGAGTGACAGATGCTTTCCCCAAAAAAGAAGAAATGACAGAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 9897 31319 95 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44067539)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAGGTCCTCTTTTTAATAAAAAAATAATAGAAAATGCATTTAAAAAC[A/T]AAGATGTTCCTCTTCCCATTAAACAGGGATTGACCCCTAAAAGGGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099   10183 31319 97 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515 Essential Splice Site 225 400 None 10
Genomic Location:
Chromosome 9 (position 44065400)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATAAACTCATCTCAAARCCCAAGGAAGAGAAGACAATTCCAACAAAAGG[T/A]ATTATGTTARCCTCAAGTCTGCACCCCTGTAAGTTCCTGAAAAGGAARGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 10499 31319 100 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44063638)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGGGTAAAGGAAAGATTCCATCTAAAGACCAGGACCCTGAGAAAGTT[C/T]AACTAAAACCTTTTACGAAGAAGCCTTCAGCTGGATCACCTAAAGAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 10749 31319 100 230
ENSDART00000126871   None 22089 None 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44062888)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAATATGAAGATGAAGAAGAAGAAGCATGGGGATGGGAGCTTGCTTCT[C/T]GAGACAGTTATGGTTCAGAGGGCTCTGAAGAACAATATTTGGAGGAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 10969 31319 102 230
ENSDART00000126871 Nonsense 207 22089 3 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44061445)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCAAGCAAATTGCTGGCAAAGTTCAAGTCAATGTTATTGGACTGCAG[C/T]GATCAGCAACGATCCAGGACACCAATGATGATGATGCTGGTGTTTATACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12350
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 11026 31319 103 230
ENSDART00000126871 Nonsense 264 22089 4 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44061190)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCWTTGAGGGACCAGCATGTAAAACCAAAAGCTACCGCCACATTCAAATG[T/A]GAACTCTACAAGGACACTCCCAACTGGAAGTGGTTCAAGGGAGATGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Essential Splice Site 12176 31319 121 230
ENSDART00000126871 Essential Splice Site 1398 22089 22 135
ENSDART00000138515   None 400 None 10
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Essential Splice Site 12176 31319 121 230
ENSDART00000126871 Essential Splice Site 1398 22089 22 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44050615)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACACATTAGTTTGTACATAATACTGATTGTACGATTTTTGTTACCAC[A/T]GAGGAGGAGGCTAGATTCACAAAGAACTTGGCTAACATTGAAGGCACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Essential Splice Site 12176 31319 121 230
ENSDART00000126871 Essential Splice Site 1398 22089 22 135
ENSDART00000138515   None 400 None 10
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Essential Splice Site 12176 31319 121 230
ENSDART00000126871 Essential Splice Site 1398 22089 22 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44050615)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACACATTAGTTTGTACATAATACTGATTGTACGATTTTTGTTACCAC[A/T]GAGGAGGAGGCTAGATTCACAAAGAACTTGGCTAACATTGAAGGCACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 13381 31319 136 230
ENSDART00000126871 Nonsense 2603 22089 37 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44043783)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTCTCATTGAAGGACAGTGGTATGCTTATCGTGTGCGGGCTTTGAAC[A/T]AACTGGGTGCTAGTAAGCCTTGCAAGTCAACAGATGAGATCTTGGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 13557 31319 138 230
ENSDART00000126871 Nonsense 2779 22089 39 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44043051)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGTGAAATCTGGTACAAGCTGTCCTCCACTGTGAAGCAGACCACCTA[C/A]AAGGCCACCAAGCTTGTGGCTTTCAAGGAGTACATCTTTAGGGTGTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 13632 31319 139 230
ENSDART00000126871 Nonsense 2854 22089 40 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44042725)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTRTCYTGGTATGAGCCTGATGAGGATGGTGGAAGTCCTATTACTGGATA[T/G]TGGGTAGAAAGATATGAGCCTGACCATGACAAATGGATCAGATGCAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 104 17628 2 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 13800 31319 142 230
ENSDART00000126871 Nonsense 3022 22089 43 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44041787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATGTATGACTTTTCTCAACAATTATCTTTCTCTTTTAGATCCTCCAT[C/G]ACCACCAAGATGGCTTCTAGTAGTTTCTAGTAGCAGGAACAGCGCTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14025
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 557 17628 7 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 14253 31319 147 230
ENSDART00000126871 Nonsense 3475 22089 48 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44038191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGCAGGCAGGAGAACCTATGTCAAAGTTATGTCTGGCGAAAACAAAK[T/A]GAGTTGGCCTGTAAAGGATCTCATTCAGAATGGAGAGTACTACTTCCGYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 671 17628 8 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 14367 31319 148 230
ENSDART00000126871 Nonsense 3589 22089 49 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44037756)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCCGGTGTTGTCTTATACTGTTAAGGGGTTGACACATGAAAAACAATA[T/A]CAGTTCCGGGTTCGTGCAGAGAATGCAGCTGGTGTCAGTGATCCTTCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34744
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 718 17628 9 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 14414 31319 149 230
ENSDART00000126871 Nonsense 3636 22089 50 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44037526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCTAAGGTATTCCTTAGCGGTAGTCTACAATCAGGCTTGGCTGTGAAA[C/T]GAGGTGAAGAAATCAGATTGGATGCCAACATCTCTGGATTTCCCTACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 1469 17628 16 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 15179 31319 156 230
ENSDART00000126871 Nonsense 4385 22089 57 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44034506)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATATAGTGGCTCCAAGTTTGCGTATGCTGAAACACTTCAAGGGTGATT[T/A]GATTCGAGTAAGGAAAAATGAGCCTATTGAGATGCCTGCAGAAGTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Essential Splice Site 1558 17628 16 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Essential Splice Site 15268 31319 156 230
ENSDART00000126871 Essential Splice Site 4474 22089 57 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44034238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAATCGTTTGGGAACGCTGAGTCATTCGGTCACAGTGGAAGTGTTGGG[T/G]AAGTTATGATATACTGTACAACAATAAGTATTATAACTCACATTTAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 1845 17628 19 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 15555 31319 159 230
ENSDART00000126871 Nonsense 4761 22089 60 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44032992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTGTGTTCACCATTCCAAACCTCCCAGAACTTAAGAAATACAGATTC[A/T]GAATCATTGCAGTCAATGAAATTGGAGAGTCTGAGCCTAGTCCCAGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1736
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 2130 17628 23 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 15840 31319 163 230
ENSDART00000126871 Nonsense 5046 22089 64 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44031093)
KASP Assay ID:
554-1681.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAACGTCTGAGCTGGGACACAAGTGGTCCACAGAAAGAGACTTGGAAA[C/T]AGTGCAACAAGAGAGATGTTGAAGAGACTACCTTCATCATTGAAGACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Essential Splice Site 2380 17628 25 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Essential Splice Site 16090 31319 165 230
ENSDART00000126871 Essential Splice Site 5296 22089 66 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44030160)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGGACCACCTTTGTACAGTGAACCCGAGAAAGCACGAAATCTCTTCAG[T/G]AAGTTTTATTCACCAAAACCTCTAAATTTGCCTTGTGGACCGTGTGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 2698 17628 30 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 16408 31319 170 230
ENSDART00000126871 Nonsense 5719 22089 72 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44026694)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATGTTGAGGTGACAGCCATCACAAATGATTCAATCAGTGTCGCATGG[A/T]GATCTCCAAAATATGATGGAGGGTCAGACATTACAAGCTATGTTCTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 3202 17628 35 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 16912 31319 175 230
ENSDART00000126871 Nonsense 6223 22089 77 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44024653)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCTCGTGAGTTGAAAGCAATGGCTGGAACCCATATTAATAWCATGGCT[G/T]GAATCAAAGGGATGCCTTTCCCTAAAGTCACCTGGAAGAAAAATRAGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 3447 17628 37 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 17173 31319 177 230
ENSDART00000126871 Nonsense 6468 22089 79 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44023560)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGCAATTGGTCTAAGTAGACCAGACACCACTGTGCCAGTTCTTTGT[C/T]AGGAAAAACTAGGTGACATTMACATTTTAACATCTAATATGTTTATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2512
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 3805 17628 38 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 17531 31319 178 230
ENSDART00000126871 Nonsense 6826 22089 80 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44022382)
KASP Assay ID:
554-3186.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAGGAGGTGCTGAGTGGGAGAAAGTCAATAAGGATGATCTGATTAAA[C/T]AGTGTGCTTATAGGGTGAAAGGACTGACTGAAGACACTGAGTACAGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 4162 17628 38 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 17888 31319 178 230
ENSDART00000126871 Nonsense 7183 22089 80 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44021310)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCTTGACATGAAATTTGTTGGCACTATTGTGGTCAAAGCAGGTGAAT[C/A]AGTTAGACTTGAAGCTGGACTTAGAGGAAAACCACAGCCCACGGTTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1029
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 4517 17628 39 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 18243 31319 179 230
ENSDART00000126871 Nonsense 7538 22089 81 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44020147)
KASP Assay ID:
554-0933.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGACAGCTTGTCTTAACTGAATACACAATCWGTAACTTGGATGAGAGA[C/T]AGGAATATGAATTCCGTGTGTCTGCTCAAAACCAAGTTGGTATGGGCCGT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Hatching:Pec-fin
ZFS:0000034
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Pec-fin
ZFS:0000034
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Pec-fin
ZFS:0000034
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Pec-fin
ZFS:0000034
larval locomotory behavior
GO:0008345
disrupted
PATO:0001507
abnormal
PATO:0000460
Hatching:Pec-fin
ZFS:0000034
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Hatching:Pec-fin
ZFS:0000034
whole organism
ZFA:0001094
decreased size
PATO:0000587
abnormal
PATO:0000460
mRNA Expression Profiling Preview:
View complete mRNA expression profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
21:24474501-24474821 24474821 1 3.82 × 10-153 -3.0 0 wu:fb15e04 ENSDARG00000056248
6:269178-269600 269178 -1 2.54 × 10-93 -2.7 -2 pde6h ENSDARG00000070439
11:26416101-26416749 26416749 1 1.48 × 10-89 -3.0 -16 opn1lw2 ENSDARG00000044861
8:55706885-55707600 55706885 -1 1.55 × 10-78 -2.7 0 rho ENSDARG00000002193
19:5730430-5731200 5730430 -1 2.91 × 10-76 -3.1 -1 gnb3b ENSDARG00000002696

Mutation Details

Allele Name:
sa21575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 4646 17628 41 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 18372 31319 181 230
ENSDART00000126871 Nonsense 7667 22089 83 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44019595)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTATCTTCTACAAAGTTGTTTCTGAAATTAATCAACAGATACTCCT[G/T]GACCTGTTGGTGGACTGGACGCAACTGATATCACAAAGACATCCTGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 4698 17628 41 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 18424 31319 181 230
ENSDART00000126871 Nonsense 7719 22089 83 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44019438)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAAGCGTGAAGTTGACAGGAAAACATGGACAAATTGCACAAACGATT[T/A]GAAGAAGACAAGTTTCAAAATCACAAATCTGACTCCAGGAATAGAGTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 4815 17628 42 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 18541 31319 182 230
ENSDART00000126871 Nonsense 7836 22089 84 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44019003)
KASP Assay ID:
2260-2383.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAAGACTTAACAATTGTTGTTGCTGGACTGAAAGAAAACACTAAATA[C/A]AGGTTCAGGGTTGCAGCAAGAAATGCAATAGGATGCAGTTTGGCAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Essential Splice Site 5636 17628 50 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Essential Splice Site 19362 31319 190 230
ENSDART00000126871 Essential Splice Site 8657 22089 92 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44014872)
KASP Assay ID:
554-6629.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGAGCCAAGTGAAGTTCCTGAAAAACATTTGGCAAAGGATATCTTACG[T/G]AAGTAAATCTAACAACTGATTTTTTTTNNNNNNNNNAAAAGGAGTACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 5652 17628 51 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 19378 31319 191 230
ENSDART00000126871 Nonsense 8673 22089 93 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44014731)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGCCCCTGAGGCTGAACTTGATGCTGATCTCAGAAAAGCACTTGTTT[T/A]ACGTGCTGGAGTAACAATGAGAATTTACGTGCCTCTAAGAGGGCGTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 5830 17628 53 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 19556 31319 193 230
ENSDART00000126871 Nonsense 8851 22089 95 135
ENSDART00000138515   None 400 None 10
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 5830 17628 53 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 19556 31319 193 230
ENSDART00000126871 Nonsense 8851 22089 95 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44014033)
KASP Assay ID:
2260-2380.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTTAAATATGCATATAGCCATATTCTAACTTTGATGTCWATTRCAGAA[C/T]AACCTGGACCAGTTGCAGAATTTAAATCAATRGAGATCACCAAGAATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 5830 17628 53 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 19556 31319 193 230
ENSDART00000126871 Nonsense 8851 22089 95 135
ENSDART00000138515   None 400 None 10
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 5830 17628 53 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 19556 31319 193 230
ENSDART00000126871 Nonsense 8851 22089 95 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44014033)
KASP Assay ID:
2260-2380.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTTAAATATGCATATAGCCATATTCTAACTTTGATGTCTATTGCAGAA[C/T]AACCTGGACCAGTTGCAGAATTTAAATCAATGGAGATCACCAAGAATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 6609 17628 59 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 20300 31319 198 230
ENSDART00000126871 Nonsense 9630 22089 101 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44010669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGACTGCAGAGAATAAAGCTGGTTTTGGTGAACCCAGTGAGCCATCA[C/T]AACCTGTAATGACAAAGGATATTGCATGTAAGATGATCATTGCCAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 6674 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 20365 31319 199 230
ENSDART00000126871 Nonsense 9695 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44010345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATAAAAAGGAAGGTGATGATGACTGGGTTCAAGACACAACTATTCCCT[T/A]GAGAAWAACAGAATTTGTGGTATCAAATCTACAGTCAGGAGGAAAATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 6884 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 20575 31319 199 230
ENSDART00000126871 Nonsense 9905 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44009714)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCAGAAATGCTCATACAAGATTCCAGACTTAGAAGAGGCTGCTGAATA[T/A]TACTTTAGAGTTTCAGCTGAAAATGAAATGGGCATCGGTGAACCAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16825
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 7599 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 21290 31319 199 230
ENSDART00000126871 Nonsense 10620 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44007569)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTGGGAGAACCTCTTGAATCTGAACCTGCTGTTGCTACTAATCCGTA[T/A]GTGCCATCTGATCCTCCACAGGCACCAGAAGTAACTGCTATCACAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13049
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 7952 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 21643 31319 199 230
ENSDART00000126871 Nonsense 10973 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44006510)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAACGTGAAWCTACAAGAAAAGCATATTCCATTGTCAATGCCTCTTG[T/A]CCTAAAACAAGTTGGAGAATTGGAGATTTACAAGAAGGAAATTTGTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 7985 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 21676 31319 199 230
ENSDART00000126871 Nonsense 11006 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44006413)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCTTCAGAATTTTGGCAGAAAATGAGTATGGTGTAGGTCTTCCAGTA[G/T]AGACAATGGAAGCTATAAAAATCTCTGAGAGACCTCTTCCTCCAGGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 8346 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 22037 31319 199 230
ENSDART00000126871 Nonsense 11367 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44005330)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACAGCTTGCTGTGGGTGAAACAAAACAAAACAATCATTCCAGAMACA[C/T]GATTCAAGATAGGTGGTCTTGAAGAAGGCATTGAATATGAATTTAGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 8795 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 22486 31319 199 230
ENSDART00000126871 Nonsense 11816 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44003981)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGATCCAGTCTTTAAGCCTGGCCCACCCAACAACCCTAAAGTAGCTTA[T/A]GTGTCAAGAGCATCTGTTGTACTGCATTGGAGCAAGCCAATTTACGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 8819 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 22510 31319 199 230
ENSDART00000126871 Nonsense 11840 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44003909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCATTGGAGCAAGCCAATTTACGATGGTGGCTGTGAGATTCAAAGTTA[T/A]ATTGTTGAGGCATGTGAAGTCACTTCAGATGAATGGGTGATGTGTACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 8935 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 22626 31319 199 230
ENSDART00000126871 Nonsense 11956 22089 102 135
ENSDART00000138515   None 400 None 10
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 8935 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 22626 31319 199 230
ENSDART00000126871 Nonsense 11956 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44003563)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTGAAGTCAAATGGGGAAAAACTGAAGGTGAAATCAATGAGRCAGCA[C/T]AGATTGATATTACAAGCAGTTTTACCTCACTTGTAATTGAAAATGTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 8935 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 22626 31319 199 230
ENSDART00000126871 Nonsense 11956 22089 102 135
ENSDART00000138515   None 400 None 10
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 8935 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 22626 31319 199 230
ENSDART00000126871 Nonsense 11956 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 44003563)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTGAAGTCAAATGGGGAAAAACTGAAGGTGAAATCAATGAGRCAGCA[C/T]AGATTGATATTACAAGCAGTTTTACCTCACTTGTAATTGAAAATGTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 10291 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 23982 31319 199 230
ENSDART00000126871 Nonsense 13312 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43999493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAAGTGGAAATACCATTTAAAGGGCGTCCAACTCCAAAGATTGGATG[G/A]ATGAAAGATGGACAAGCACTTAAAGAGACAACCAGATTAAATGTCTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 11255 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 24946 31319 199 230
ENSDART00000126871 Nonsense 14276 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43996603)
KASP Assay ID:
554-0692.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCCAAGCACCCTTACCACCTGGTAAAATTACAGTTATTGATGTAACT[C/T]GACACACTGTTACTTTGTCATGGGAAAAGCCAGATCATGATGGTGGCAGC
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 48 hpf

Control on top; Mutant below; 48 hpf

zoom

Control; 48 hpf

Control; 48 hpf

zoom

Mutant; 48 hpf

Mutant; 48 hpf

zoom

Stage Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
larval locomotory behavior
GO:0008345
absent
PATO:0000462
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
skeletal muscle
ZFA:0005277
quality
PATO:0000001
abnormal
PATO:0000460
mRNA Expression Profiling Preview:
View complete mRNA expression profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
9:23161853-23162200 23161853 -1 2.05 × 10-155 -1.9 -6 zgc:165347 ENSDARG00000088687
9:23124508-23124900 23124508 -1 1.92 × 10-153 -1.5 0 crygm2d13 ENSDARG00000057460
10:45523367-45523800 45523367 -1 4.98 × 10-129 -1.2 -3 crybb1 ENSDARG00000068507
9:43967893-43968500 43967893 -1 2.37 × 10-93 -1.5 -5 ttna ENSDARG00000028213
9:23168078-23168400 23168078 -1 1.86 × 10-78 -2.1 -2 crygm2d8 ENSDARG00000069817

Mutation Details

Allele Name:
sa14565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 11350 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 25041 31319 199 230
ENSDART00000126871 Nonsense 14371 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43996316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAGAGATATTACTATTGAACCCATTATTGATTTGATGTTCAATACCTA[C/A]AGTGTAAAAGCTGGAGATGATCTCAAAATAGATGTTCCGTTCAGAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 11468 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 25159 31319 199 230
ENSDART00000126871 Nonsense 14489 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43995962)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCATGGGACCCTCCGATRTATGATGGTGGCTGTCAAATTAATAATTA[T/A]GTAGTTGAAAAAAGAGATACGACTACTACAGCATGGCAAATTGTWTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 11593 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 25284 31319 199 230
ENSDART00000126871 Nonsense 14614 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43995589)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTCTTTGGACAAAGATGAACAGAGGACTTATAACAGAAACTCAGTTC[A/T]AAGTAACTGGCTTGGAAGAAGGCCTACAGTATCAGTATAGAGTATATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 11800 17628 60 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 25491 31319 199 230
ENSDART00000126871 Nonsense 14821 22089 102 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43994968)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTTCTTCAACACTTACTAGTACAACGCTAATTGTGAGAGATGCCATT[A/T]GACGTGATTCAGGACAGYATKTTCTAACGTTACAGAATGTTGCAGGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2493
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 12384 17628 61 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 26075 31319 200 230
ENSDART00000126871 Nonsense 15405 22089 103 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43993105)
KASP Assay ID:
554-2808.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATAAAGTGTGGTTCCACCAAATCCACTCATTTCGTTGTTGATGGTTTG[A/T]GAGAAAATGCTGAATACTACTTCAGAGTTCGTGCTGAAAACCATGCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 13051 17628 66 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 26742 31319 205 230
ENSDART00000126871 Nonsense 16072 22089 108 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43990451)
KASP Assay ID:
2260-2360.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RACCAAGTTTGGATGGTGGCAGTGACATTGATGGATATTACTTAGAGAAA[C/T]GAGAGAAGAAAAGTCTACAGTGGTTCAAGGTTATAAAAGATCCAATCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Essential Splice Site 13212 17628 67 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Essential Splice Site 26903 31319 206 230
ENSDART00000126871 Essential Splice Site 16233 22089 109 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43989872)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACGTTCGATTGAGATTGTGCAGCCAGTGCAGGCCAAAGATATTCTGG[G/A]TTTGTACTTTTTAACGGTCAAAATTATAAAATGTTTTACTGATTTTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 13580 17628 68 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 27271 31319 207 230
ENSDART00000126871 Nonsense 16601 22089 110 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43988678)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCWAGTCTCATTGTAAGAAATGCAAGAAAGGAAAATGCAGGAAAATA[C/A]ACYTTGGTACTTGATAACAAACTTGTCAAGAACTTCTTTGACATCAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2492
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 13780 17628 68 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 27471 31319 207 230
ENSDART00000126871 Nonsense 16801 22089 110 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43988080)
KASP Assay ID:
554-2790.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTCATTGGACTTATTGAAGGTCTGGAATATTCATTCAGAGTGTATGCA[C/T]AAAACAATGCTGGAATGAGTCCAGTCAGTGAACAGAGCAAACACAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 14128 17628 72 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 27819 31319 211 230
ENSDART00000126871 Nonsense 17149 22089 114 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43986485)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTCTGTGCTGGACAAGACCAAGACATGATGGTGGAAATGAAATTAAA[C/T]AATACATCCTTGAAAGACGGGAAAAGAAGAGTTTAAGATGGGTGAAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 14431 17628 72 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 28122 31319 211 230
ENSDART00000126871 Nonsense 17452 22089 114 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43985576)
KASP Assay ID:
554-1658.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCATCAAATGATGGAGGGGCACGTGTTCATCACTACATTGTTGAAAAG[C/T]GAGAGGCAAGTCGATTAAGTTGGCAGGAGGTCAGTGAAAGGTGCACACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 15005 17628 75 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 28696 31319 214 230
ENSDART00000126871 Nonsense 18026 22089 117 135
ENSDART00000138515   None 400 None 10
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 15005 17628 75 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 28696 31319 214 230
ENSDART00000126871 Nonsense 18026 22089 117 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43983572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCGAGCTGGACAGTAAACTTGTGGGTGAGACAATCTCCATTAGAGCT[G/T]GATCAGACCTTGTTCTTGATGCTGCTGTTGGTGGAAAACCAGAACCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41526
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 15005 17628 75 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 28696 31319 214 230
ENSDART00000126871 Nonsense 18026 22089 117 135
ENSDART00000138515   None 400 None 10
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 15005 17628 75 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 28696 31319 214 230
ENSDART00000126871 Nonsense 18026 22089 117 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43983572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCGAGCTGGACAGTAAACTTGTGGGTGAGACAATCTCCATTAGAGCT[G/T]GATCAGACCTTGTTCTTGATGCTGCTGTTGGTGGAAAACCAGAACCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Essential Splice Site 16473 17628 87 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Essential Splice Site 30164 31319 226 230
ENSDART00000126871 Essential Splice Site 19494 22089 129 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43977299)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGTAGACCAAGAAGAACAGCAATGGGCATTAAAACCAAACTGAGTGG[T/A]AAGTTAATGCAATGCCACTTAGATTTTTTTTTTTCTGAAACAAATTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 16688 17628 89 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 30379 31319 228 230
ENSDART00000126871 Nonsense 19709 22089 131 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43976446)
KASP Assay ID:
554-7783.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCAGTCGTTGTTGATGCTCTATTGAAGAGTTCTGTGATCATTAGTTG[G/A]AAACCACCAAAGGATGATGGTGGATCAATGATCACAAATTACATTGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 16926 17628 90 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 30617 31319 229 230
ENSDART00000126871 Nonsense 19947 22089 132 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43975634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAAGAAATTTTAGCTGATGGAGCGAAAATAAAGGTCCAAGAATTCAAA[G/T]GAGGTTACTTCCAACTAGTTATCAGCAACGCTGATGAAAATGATGCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677 Nonsense 17611 17628 91 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099 Nonsense 31302 31319 230 230
ENSDART00000126871 Nonsense 20632 22089 133 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43973465)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATATGCTGAGTTATTTGTTGAGACTGTCAGGTCCTTCCGTGAGTACTA[C/A]CTTGGACGCTCGCTGAAGAAACCCAGGCGTAGAATTGACAAAAGCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000591   None 7601 None 74
ENSDART00000017677   None 17628 None 91
ENSDART00000059460   None 7601 None 75
ENSDART00000109099   None 31319 None 230
ENSDART00000126871 Nonsense 21395 22089 133 135
ENSDART00000138515   None 400 None 10
Genomic Location:
Chromosome 9 (position 43971177)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCTGCCTCAAGAACTCACTTGGAGATTCAAGAATTCAAAACAAAGT[T/A]AACCGAGAGACATGAAGTTTCTTCCTTTGAAAAGTATGAATCTCAGAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)
  • RR interval (heart rate): A genome-wide association scan of RR and QT interval duration in 3 European genetically isolated populations: the EUROSPAN project. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link