ube2v2

Ensembl ID:
ENSDARG00000028198
ZFIN ID:
ZDB-GENE-040426-2919
Description:
Ubiquitin-conjugating enzyme E2 variant 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6PEH5]
Human Orthologue:
UBE2V2
Human Description:
ubiquitin-conjugating enzyme E2 variant 2 [Source:HGNC Symbol;Acc:12495]
Mouse Orthologues:
Gm10088, Ube2v2
Mouse Descriptions:
predicted gene 10088 Gene [Source:MGI Symbol;Acc:MGI:3641695]
ubiquitin-conjugating enzyme E2 variant 2 Gene [Source:MGI Symbol;Acc:MGI:1917870]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15834 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15834
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026578 Nonsense 113 145 4 4
Genomic Location:
Chromosome 24 (position 37018683)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTGGAKGCACGTAGCATACCAATTCTAGCAAAATGGCAAAACTCATA[T/A]AGCATTAAAGTCGTTCTTCAAGAGCTAAGGCGTCTTATGATGTCCAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/95q8zdp4