pax2a

Ensembl ID:
ENSDARG00000028148
ZFIN ID:
ZDB-GENE-990415-8
Description:
Paired box protein Pax-2a [Source:UniProtKB/Swiss-Prot;Acc:Q90268]
Human Orthologue:
PAX2
Human Description:
paired box 2 [Source:HGNC Symbol;Acc:8616]
Mouse Orthologue:
Pax2
Mouse Description:
paired box gene 2 Gene [Source:MGI Symbol;Acc:MGI:97486]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11077 Essential Splice Site Available for shipment Available now
sa22324 Essential Splice Site Available for shipment Available now
sa24936 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11077
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076992 Essential Splice Site 140 410 4 11
ENSDART00000076998 Essential Splice Site 136 391 4 10
ENSDART00000132004   None 292 None 8
ENSDART00000133796 Essential Splice Site 126 375 3 9
ENSDART00000134330 Essential Splice Site 136 406 4 11
ENSDART00000134424 Essential Splice Site 136 292 4 8
ENSDART00000138332 Essential Splice Site 136 400 4 11
ENSDART00000139782 Essential Splice Site 126 396 3 10
ENSDART00000141310 Essential Splice Site 126 390 3 10
ENSDART00000144443 Essential Splice Site 126 381 3 9

The following transcripts of ENSDARG00000028148 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 30001915)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29647863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGCGAACCARCTGCACCTTCAACTCATTGTGTTCTTTYCCATTTYGT[A/G]GGATAATTCGAACCAAAGTTCAGCAGCCTTTYCACCCATCCTCCGACGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076992 Essential Splice Site 140 410 4 11
ENSDART00000076998 Essential Splice Site 136 391 4 10
ENSDART00000132004   None 292 None 8
ENSDART00000133796 Essential Splice Site 126 375 3 9
ENSDART00000134330 Essential Splice Site 136 406 4 11
ENSDART00000134424 Essential Splice Site 136 292 4 8
ENSDART00000138332 Essential Splice Site 136 400 4 11
ENSDART00000139782 Essential Splice Site 126 396 3 10
ENSDART00000141310 Essential Splice Site 126 390 3 10
ENSDART00000144443 Essential Splice Site 126 381 3 9

The following transcripts of ENSDARG00000028148 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 30001916)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29647864
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCGAACCAGCTGCACCTTCAACTCATTGTGTTCTTTCCCATTTCGTA[G/T]GATAATTCGAACCAAAGTTCAGCAGCCTTTCCACCCATCCTCCGACGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076992 Nonsense 143 410 4 11
ENSDART00000076998 Nonsense 139 391 4 10
ENSDART00000132004   None 292 None 8
ENSDART00000133796 Nonsense 129 375 3 9
ENSDART00000134330 Nonsense 139 406 4 11
ENSDART00000134424 Nonsense 139 292 4 8
ENSDART00000138332 Nonsense 139 400 4 11
ENSDART00000139782 Nonsense 129 396 3 10
ENSDART00000141310 Nonsense 129 390 3 10
ENSDART00000144443 Nonsense 129 381 3 9

The following transcripts of ENSDARG00000028148 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 30001924)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29647872
KASP Assay ID:
554-7776.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCTGCACCTTCAACTCATTGTGTTCTTTCCCATTTCGTAGGATAATT[C/T]GAACCAAAGTTCAGCAGCCTTTCCACCCATCCTCCGACGGCACAGGAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link