si:ch211-69g13.1

Ensembl ID:
ENSDARG00000028118
ZFIN ID:
ZDB-GENE-031118-67
Description:
Novel protein similar to Down syndrome cell adhesion molecule (Dscam) [Source:UniProtKB/TrEMBL;Acc:A
Human Orthologue:
DSCAM
Human Description:
Down syndrome cell adhesion molecule [Source:HGNC Symbol;Acc:3039]
Mouse Orthologue:
Dscam
Mouse Description:
Down syndrome cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1196281]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2791 Nonsense F2 line generated During 2017
sa28403 Nonsense Mutation detected in F1 DNA During 2017
sa39033 Nonsense Mutation detected in F1 DNA During 2017
sa22586 Nonsense Available for shipment Available now
sa14192 Nonsense Available for shipment Available now
sa13818 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2791
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098038 Nonsense 356 2020 6 33
ENSDART00000148350 Nonsense 187 1905 3 30
Genomic Location (Zv9):
Chromosome 15 (position 6132508)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 6250301
KASP Assay ID:
554-2683.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCAGACGAGTTTGACATCACCTGGTACAGGAATGCGGAGAAGATCTAT[C/T]AGGGTATAAATGTACGAATCACGGGCATTAACAACGAGAACCTGGTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098038 Nonsense 1025 2020 17 33
ENSDART00000148350 Nonsense 856 1905 14 30
Genomic Location (Zv9):
Chromosome 15 (position 6073422)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 6191215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCACAAACACTTGCAAAATGGCTTGATCCGAAGCTACCAAGTGTGCTA[T/A]CGGGAGTTCGGGACAGGAGGCAGCCCACAATACAACACCATCAACGTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098038 Nonsense 1254 2020 21 33
ENSDART00000148350 Nonsense 1085 1905 18 30
Genomic Location (Zv9):
Chromosome 15 (position 6061116)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 6178909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTGAAGCCGCACCTGATGTTTATTTCCGTCGCTTGACCAACTTGAAC[C/T]AGAATTGGCAGTACAGCATCTGGGTTGTGGCGGTGACTGCGGCAGGTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098038 Nonsense 1376 2020 23 33
ENSDART00000148350 Nonsense 1207 1905 20 30
Genomic Location (Zv9):
Chromosome 15 (position 6057987)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 6175780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTGTTGCCAGCAACAACTGGGGTTCCGATGAGATCATGCTAAATCTT[C/T]AGGTCCAAGGTGTGTTTGTAATCTTCAGAGACAGCCTTTTTTAATTTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098038 Nonsense 1447 2020 25 33
ENSDART00000148350 Nonsense 1245 1905 21 30
Genomic Location (Zv9):
Chromosome 15 (position 6055564)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 6173357
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCCCAGTGAGCGCTCTTACCGTCTGGAGAATCTGAAGTGCGGTACTTG[G/A]TACAAGTTTACTCTGACTGCACAGAATGCARTAGGTCCCGGACGCATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098038 Nonsense 1980 2020 33 33
ENSDART00000148350 Nonsense 1865 1905 30 30
Genomic Location (Zv9):
Chromosome 15 (position 6034077)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 6151870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAGAGGCGGTACAGCAGTGGCAGCCGGGAACTGCCTCTACACTGCCA[C/T]AGCGCGAGCCGGGCGACCTRGCYCAGGCCGCCAAACTCAGCAGCTCCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Non-small cell lung cancer: Genome-wide association study on overall survival of advanced non-small cell lung cancer patients treated with carboplatin and paclitaxel. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Platelet counts: Duffy-null-associated low neutrophil counts influence HIV-1 susceptibility in high-risk South African black women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link