glrx

Ensembl ID:
ENSDARG00000028106
ZFIN ID:
ZDB-GENE-041010-11
Description:
glutaredoxin-1 [Source:RefSeq peptide;Acc:NP_001005942]
Human Orthologue:
GLRX
Human Description:
glutaredoxin (thioltransferase) [Source:HGNC Symbol;Acc:4330]
Mouse Orthologue:
Glrx
Mouse Description:
glutaredoxin Gene [Source:MGI Symbol;Acc:MGI:2135625]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32336 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031786 Essential Splice Site 68 105 1 3
ENSDART00000081646   None 105 None 4
ENSDART00000103165   None 44 None 3
ENSDART00000134469   None 105 None 4

The following transcripts of ENSDARG00000028106 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 10203092)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11686455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGGGCAGCATACAGGACTATCTGCAACAGATCACGGGCGCGCGCACT[G/A]TGAGTACTTTAACGTTTGTGGAATATTATTATATATATTAAACTGTTAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link