sh2d3ca

Ensembl ID:
ENSDARG00000028099
ZFIN ID:
ZDB-GENE-080102-1
Human Orthologue:
SH2D3C
Human Description:
SH2 domain containing 3C [Source:HGNC Symbol;Acc:16884]
Mouse Orthologue:
Sh2d3c
Mouse Description:
SH2 domain containing 3C Gene [Source:MGI Symbol;Acc:MGI:1351631]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16477 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029457 Essential Splice Site 6 905 1 12
ENSDART00000144214   None 678 None 10
Genomic Location (Zv9):
Chromosome 10 (position 10144164)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10220030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCCTGCCGGACATACAAGRGGCTAAACCATGATCAAGCGCAAGCTGA[G/A]TGAGTATGTTTGATTGTGGACTTCCGGCATAGTATGGCGAAATYATTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link