galk1

Ensembl ID:
ENSDARG00000028088
ZFIN ID:
ZDB-GENE-041010-79
Description:
galactokinase [Source:RefSeq peptide;Acc:NP_001006002]
Human Orthologue:
GALK1
Human Description:
galactokinase 1 [Source:HGNC Symbol;Acc:4118]
Mouse Orthologue:
Galk1
Mouse Description:
galactokinase 1 Gene [Source:MGI Symbol;Acc:MGI:95730]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22146 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030566 Essential Splice Site 316 393 6 8
Genomic Location (Zv9):
Chromosome 12 (position 35289917)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33693943
KASP Assay ID:
2260-5625.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACAAAGAGTTTGGGAGGCTGATGGTGGAGAGCCACAATTCTCTGAGG[T/G]AAACATTTATAATCGAAGCAAGATTATCATGACTCTGTGAAAGCATCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link